C7ORF41 Regulates Inflammation by Inhibiting NF-κB Signaling Pathway

Zhou, Jinping; Zhou, Quan; Zhang, Tan; Fan, Jingyi

doi:10.1155/2021/7413605

Cited by 4 publications

(9 citation statements)

References 31 publications

(18 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…NF-κB is known to transactive inflammatory cytokines to be activated by IKKα/β and p65. 29 To further investigate the mechanism of CBD and DEX inhibition of the pro-inflammatory cytokines, the IKKα/β and p65 in LPS-induced RAW264.7 cells were examined by Western blot analysis. As shown in Figure 3B , the level of phosphorylated IKKα/β and p65 were increased with LPS treatment when compared with untreated cells.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Comparison of the in vitro Anti-Inflammatory Effect of Cannabidiol to Dexamethasone

Wang¹,

Wang²,

Yang³

et al. 2022

CCID

View full text Add to dashboard Cite

Background Cannabidiol (CBD) is a non-psychoactive phytocannabinoid constituent of Cannabis sativa with pain-relieving and anti-inflammatory properties. With the emphasis on natural ingredients in cosmetics, CBD has become a new cosmetic ingredient due to its ability to alleviate inflammation. However, in-depth studies that directly compare the effective mechanism and the therapeutic potential of CBD are still needed. Purpose The aim of the present study was to investigate the anti-inflammatory effect of CBD in lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages and compare it to dexamethasone (DEX). Methods RAW264.7 macrophages in the logarithmic growth phase were incubated in the presence or absence of LPS. After that, the production of nitric oxide (NO), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) were measured. A luciferase reporter assay for nuclear factor kappa B (NF-κB) was performed, and the phosphorylation levels of the mitogen-activated protein kinase (MAPK) and NF-κB signaling pathways were measured. Results The present study indicated that CBD had a similar anti-inflammatory effect to DEX by attenuating the LPS-induced production of NO, IL-6, and TNF-α. However, only CBD attenuated JNK phosphorylation levels, and only DEX attenuated IKK phosphorylation levels. Conclusion These results suggested that CBD and DEX exhibit similar anti-inflammatory effects on LPS-induced RAW264.7 macrophages mainly through suppressing the MAPK and NF-κB signaling pathways, but with different intracellular mechanisms. These findings suggested that CBD may be considered a natural anti-inflammatory agent for protecting skin from immune disorders.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Cbd and Dex Inhibit The Lps-stimulated Nf-κb Signaling Pathwaymentioning

confidence: 99%

Comparison of the in vitro Anti-Inflammatory Effect of Cannabidiol to Dexamethasone

Wang¹,

Wang²,

Yang³

et al. 2022

CCID

View full text Add to dashboard Cite

show abstract

“…The sequence is 5′‐CGATGTCGTGTTCGCAAGCAT‐3′ (shAK2). The construction of AK2‐knockdown glioma cell lines was performed as previously described 22 …”

Section: Methodsmentioning

confidence: 99%

“…Western blotting was performed following a standard protocol 22 . The primary antibodies used were as follows: anti‐β‐actin (1: 1000; AC026, Abclonal), anti‐human AK2 (1:1000, ab166901, Abcam).…”

Section: Methodsmentioning

confidence: 99%

Adenylate kinase 2 is a biomarker related to the prognosis of glioma and the immune microenvironment

Liu

Tang

et al. 2023

Clinical Laboratory Analysis

Self Cite

View full text Add to dashboard Cite

Gliomas, including lower-grade glioma (LGG) and glioblastoma (GBM), account for the vast majority of primary malignant tumors affecting the brain and other parts of the central nervous system (CNS). 1 They have received significant attention because of their dismal prognosis and poor treatment outcomes. In 2021, the WHO released the fifth edition of the WHO Classification of Tumors of the Central Nervous System (WHO CNS5), in which the glioma grading system includes four grades, WHO 1 to 4. 2 Despite the availability of several effective treatments for the disease, including maximum excision of tumor tissue, supplemented with radiotherapy and

show abstract

“…NF-κB plays a critical role in mediating responses to a remarkable diversity of external stimuli, and thus is a pivotal element in multiple physiological and pathological processes and is a powerful orchestrator of the immune response [ 24 , 25 , 26 ]. There are many reports in the literature regarding the role of NF-κB during specific parasite infections.…”

Section: Introductionmentioning

confidence: 99%

The Role of Nuclear Factor Kappa B (NF-κB) in the Immune Response against Parasites

Bąska

Norbury

2022

Pathogens

View full text Add to dashboard Cite

The immune system consists of various cells, organs, and processes that interact in a sophisticated manner to defend against pathogens. Upon initial exposure to an invader, nonspecific mechanisms are raised through the activation of macrophages, monocytes, basophils, mast cells, eosinophils, innate lymphoid cells, or natural killer cells. During the course of an infection, more specific responses develop (adaptive immune responses) whose hallmarks include the expansion of B and T cells that specifically recognize foreign antigens. Cell to cell communication takes place through physical interactions as well as through the release of mediators (cytokines, chemokines) that modify cell activity and control and regulate the immune response. One regulator of cell states is the transcription factor Nuclear Factor kappa B (NF-κB) which mediates responses to various stimuli and is involved in a variety of processes (cell cycle, development, apoptosis, carcinogenesis, innate and adaptive immune responses). It consists of two protein classes with NF-κB1 (p105/50) and NF-κB2 (p100/52) belonging to class I, and RelA (p65), RelB and c-Rel belonging to class II. The active transcription factor consists of a dimer, usually comprised of both class I and class II proteins conjugated to Inhibitor of κB (IκB). Through various stimuli, IκB is phosphorylated and detached, allowing dimer migration to the nucleus and binding of DNA. NF-κB is crucial in regulating the immune response and maintaining a balance between suppression, effective response, and immunopathologies. Parasites are a diverse group of organisms comprised of three major groups: protozoa, helminths, and ectoparasites. Each group induces distinct effector immune mechanisms and is susceptible to different types of immune responses (Th1, Th2, Th17). This review describes the role of NF-κB and its activity during parasite infections and its contribution to inducing protective responses or immunopathologies.

show abstract

C7ORF41 Regulates Inflammation by Inhibiting NF-κB Signaling Pathway

Cited by 4 publications

References 31 publications

Comparison of the in vitro Anti-Inflammatory Effect of Cannabidiol to Dexamethasone

Comparison of the in vitro Anti-Inflammatory Effect of Cannabidiol to Dexamethasone

Adenylate kinase 2 is a biomarker related to the prognosis of glioma and the immune microenvironment

The Role of Nuclear Factor Kappa B (NF-κB) in the Immune Response against Parasites

Contact Info

Product

Resources

About