Broad distribution of enterotoxin genes (hblCDA, nheABC, cytK, and entFM) among Bacillus thuringiensis and Bacillus cereus as shown by novel primers

Ngamwongsatit, Puriya; Buasri, Wasin; Pianariyanon, Panuwat; Pulsrikarn, Chaiwat; Ohba, Michio; Assavanig, Apinya; Panbangred, Watanalai

doi:10.1016/j.ijfoodmicro.2007.11.013

Cited by 168 publications

(141 citation statements)

References 19 publications

Supporting

Mentioning

115

Contrasting

Unclassified

Order By: Relevance

“…The results showed that 30% (6/20) of B. cereus isolates contained three enterotoxic HBL complex encoding genes hblA, hblC and hblD, whereas 70% (14/20) had no hbl genes. All three enterotoxic NHE complex encoding genes nheA, nheB and nheC were detected in 40% of isolates (8/20), whereas two nhe genes (nheA and nheB) were found in 45% (9/20) of the isolates [39] hblD F hblD R AGGTCAACAGGCAACGATTC CGAGAGTCCACCAACAACAG 205 [39] hblA F hblA R ATTAATACAGGGGATGGAGAAACTT TGATCCTAATACTTCTTCTAGACGCTT 237 [40] nheA F nheA R GAGGGGCAAACAGAAGTGAA TGCGAACTTTTGATGATTCG 186 [39] nheB F nheB R CCGCTTCTGCAAAATCAAAT TGCGCAGTTGTAACTTGTCC 281 [39] nheC F nheC R ACATCCTTTTGCAGCAGAAC CCACCAGCAATGACCATATC 618 [41] cytK1 F cytK1 R AACAGATATCGGTCAAAATGC CGTGCATCTGTTTCATGAGG 623 [42] and one nhe gene (two nheA and one nheB) was found in 15% (3/20) of the isolates. The ctyK1 gene was not detected in any sample (Fig.…”

Section: Resultsmentioning

confidence: 99%

Determination of Enterotoxigenic Gene Profiles of Bacillus cereus Strains Isolated from Dairy Desserts by Multiplex PCR

Onur¹

2013

Kafkas Univ Vet Fak Derg

View full text Add to dashboard Cite

The aim of this study was to investigate the presence of Bacillus cereus and to detect enterotoxigenic genes in dairy dessert samples utilising a multiplex PCR technique. A total of 100 samples, 25 keskul, 12 tavuk gogsu, 12 kazandibi, 30 supangle, 4 profiteroles and 17 sutlac were analysed. B. cereus contamination was found in 7 of 100 (7.0%) samples including 3 (25%) tavuk gogsu, 2 (6.6%) supangle, 1 (4%) keskul and 1 (5.8%) sutlac. The average number of B. cereus was between 2.0×10 1 -5.0×10 2 cfu/g in these dairy dessert samples. A total of 20 isolates were collected from the 7 positive samples. The results indicated that 30% (6/20) of B. cereus isolates contain three enterotoxic HBL complex encoding genes hblA, hblC and hblD, whereas 70% (14/20) had no hbl genes. In addition, all three enterotoxic NHE complex encoding genes, nheA, nheB and nheC, were detected in 40% (8/20), two nhe genes (nheA and nheB) were found in 45% (9/20) and one nhe gene (two nheA and one nheB) was found in 15% (3/20) of the isolates. The ctyK1 gene was not detected in any sample. The presence of B. cereus and their enterotoxigenic genes in dairy desserts may be a potential risk for public health. Keywords: B.cereus, Dairy dessert, Enterotoxin genes Sütlü Tatlılardan İzole Edilen Bacillus cereus Suşlarının Enterotoksijenik Gen Profillerinin Multipleks PCR ile Belirlenmesi ÖzetBu çalışmanın amacı sütlü tatlılarda Bacillus cereus varlığını araştırmak ve enterotoksijenik genleri multipleks PCR tekniğiyle belirlemektir. Bu amaçla 25 keşkül, 12 tavuk göğsü, 12 kazandibi, 30 supangle, 4 profiterol ve 17 sütlaç olmak üzere toplamda 100 örnek analiz edilmiştir. 3'ü tavuk göğsü (%25), 2'si supangle (%6.6), 1'i keşkül (%4) ve 1'i sütlaç (%5.8) olmak üzere toplamda 7 örnek (%7.0) B. cereus varlığı açısından pozitif bulunmuştur. Analiz edilen sütlü tatlı örneklerinde ortalama B. cereus sayısı 2.

show abstract

Section: Resultsmentioning

confidence: 99%

Determination of Enterotoxigenic Gene Profiles of Bacillus cereus Strains Isolated from Dairy Desserts by Multiplex PCR

Onur¹

2013

Kafkas Univ Vet Fak Derg

View full text Add to dashboard Cite

show abstract

“…All three compounds are toxic to Vero cells (18,32,45,46), and there is a strong correlation between the concentration of Nhe in the supernatant of a given strain and cytotoxicity (51). The nhe gene is present in all of the B. cereus strains tested, whereas hbl and cytK are present in less than 50% of randomly sampled strains (1,16,38,53,56). CytK was originally isolated from the food-borne-outbreak strain NVH 0391/98, which killed three people (46).…”

mentioning

confidence: 99%

InhA1, NprA, and HlyII as Candidates for Markers To Differentiate Pathogenic from NonpathogenicBacillus cereusStrains

Cadot

Tran

Vignaud³

et al. 2010

J Clin Microbiol

View full text Add to dashboard Cite

Bacillus cereus is found in food, soil, and plants, and the ability to cause food-borne diseases and opportunistic infection presumably varies among strains. Therefore, measuring harmful toxin production, in addition to the detection of the bacterium itself, may be key for food and hospital safety purposes. All previous studies have focused on the main known virulence factors, cereulide, Hbl, Nhe, and CytK. We examined whether other virulence factors may be specific to pathogenic strains. InhA1, NprA, and HlyII have been described as possibly contributing to B. cereus pathogenicity. We report the prevalence and expression profiles of these three new virulence factor genes among 57 B. cereus strains isolated from various sources, including isolates associated with gastrointestinal and nongastrointestinal diseases. Using PCR, quantitative reverse transcriptase PCR, and virulence in vivo assays, we unraveled these factors as potential markers to differentiate pathogenic from nonpathogenic strains. We show that the hlyII gene is carried only by strains with a pathogenic potential and that the expression levels of inhA1 and nprA are higher in the pathogenic than in the nonpathogenic group of strains studied. These data deliver useful information about the pathogenicity of various B. cereus strains.

show abstract

“…All the 44 isolates of B. cereus confirmed on molecular basis were subjected to multiplex PCR as described by the Ngamwongsatit et al, (2008) with suitable modifications. The multiplex PCR was carried in two parts, in one part HBL complex genes were characterized ( Fig.…”

Section: Resultsmentioning

confidence: 99%

“…The isolates were characterized by multiplex polymerase chain reaction by targeting six enterotoxigenic genes (hblCDA and nheABC, genes) as per the method described by Ngamwongsatit et al, (2008) with slight alterations. The multiplex PCR was standardized by using reference strain of B. cereus (NCTC11143).…”

Section: Molecular Characterization Of B Cereus Isolates Using Mpcrmentioning

confidence: 99%

Molecular Characterization of Enterotoxigenic Bacillus cereus Species Isolated from Meat Using Conventional PCR and Multiplex PCR

Badroo¹,

Rasool²,

Mudasir³

2017

Int.J.Curr.Microbiol.App.Sci

View full text Add to dashboard Cite

Broad distribution of enterotoxin genes (hblCDA, nheABC, cytK, and entFM) among Bacillus thuringiensis and Bacillus cereus as shown by novel primers

Cited by 168 publications

References 19 publications

Determination of Enterotoxigenic Gene Profiles of Bacillus cereus Strains Isolated from Dairy Desserts by Multiplex PCR

Determination of Enterotoxigenic Gene Profiles of Bacillus cereus Strains Isolated from Dairy Desserts by Multiplex PCR

InhA1, NprA, and HlyII as Candidates for Markers To Differentiate Pathogenic from NonpathogenicBacillus cereusStrains

Molecular Characterization of Enterotoxigenic Bacillus cereus Species Isolated from Meat Using Conventional PCR and Multiplex PCR

Contact Info

Product

Resources

About