BRD7 inhibits the Warburg effect and tumor progression through inactivation of HIF1α/LDHA axis in breast cancer

Abstract

The bromodomain-containing protein 7 (BRD7) was first identified as a tumor suppressor in nasopharyngeal carcinoma and has critical roles in cancer development and progression. However, the regulatory roles and mechanisms of BRD7 in cancer metabolism are still unknown. In this study, we demonstrated that BRD7 was lowly expressed in breast cancer tissues and was identified as a poor prognostic factor in breast cancer. Meanwhile, BRD7 could suppress cell proliferation, initiate cell apoptosis and reduce aerobic glycolysis, suggesting that BRD7 plays a tumor suppressive roles in breast cancer. Mechanistically, BRD7 could negatively regulate a critical glycolytic enzyme LDHA through directly interaction with its upstream transcription factor, HIF1α, facilitating degradation of HIF1α mediated by ubiquitin–proteasome pathway. Moreover, restoring the expression of LDHA in breast cancer cells could reverse the effect of BRD7 on aerobic glycolysis, cell proliferation, and tumor formation, as well as the expression of cell cycle and apopotosis related molecules such as cyclin D1, CDK4, P21, and c-PARP both in vitro and in vivo. Taken together, these results indicate that BRD7 acts as a tumor suppressor in breast cancer and represses the glycolysis and tumor progression through inactivation of HIF1α/LDHA transcription axis.

<p>Analysis of Key Genes Regulating the Warburg Effect in Patients with Gastrointestinal Cancers and Selective Inhibition of This Metabolic Pathway in Liver Cancer Cells</p>

“…A previous study showed that poly-ubiquitinated HIF1A was upregulated in BRD7-overexpressing MCF-7 breast cancer cells, indicating that BRD7 promotes the degradation of HIF1A in an ubiquitination-dependent manner in breast cancer. 30 Similarly, according to our data, HIF1A mRNA expression was upregulated, possibly revealing why BRD7 mRNA was highly expressed.…”

p53/Lactate dehydrogenase A axis negatively regulates aerobic glycolysis and tumor progression in breast cancer expressing wild‐type p53

“…Considering that p53 is a transcription factor, we then investigated whether p53 regulates the promoter activity of LDHA. As we have previously constructed a luciferase vector containing the LDHA potential promoter region (pLuc‐LDHA), we then transfected pLuc‐LDHA alone or cotransfected the p53 expression plasmid and pLuc‐LDHA into HEK293 and MCF7 cells and then detected the effect of p53 on the activity of the LDHA potential promoter using dual luciferase assays. As expected, ectopic expression of p53 greatly decreased the luciferase activity of the LDHA promoter in both MCF7 and HEK293 cells (Figure C,D).…”

“…Many oncogenic proteins and tumor suppressors may regulate carcinogenesis through their regulatory roles in bioenergetics and metabolic pathways . p53 represses the expression of several glycolytic enzymes in an indirect or direct way.…”

“…The resulting precipitated DNA specimens were analyzed by PCR to amplify the region of the potential binding site (BS) included in the LDHA promoter based on the following primers: 5′‐CCTGGGTGACAGAGTGAGAC‐3′ (forward) and 5′‐CTTTCTACTGCCCACCCCAC‐3′ (reverse), and Bak1 was used as a positive control, and the PCR primer sequence was as follows: 5′‐GGTCAAGGGCAGAGAGAGAA‐3′ (forward) and 5′‐GGAGCAGGTAGAGCCTCAGA‐3′ (reverse). The PCR products were resolved electrophoretically on a 2% agarose gel and visualized using ethidium bromide staining …”

Molecular profiling of thymoma with myasthenia gravis: Risk factors of developing myasthenia gravis in thymoma patients

“…HIFA is nuclear and constitutively expressed, whereas HIFB is cytoplasmic and controlled by oxygen-dependent enzymes. Several studies have indicated that HIF1A activity in various tumors is associated with poor prognosis through the regulation of angiogenesis, invasion, or metastasis [38][39][40]. In addition to HIF1A, HIF2A has been found to be strongly expressed in tumor-associated macrophages [41] and renal cell carcinoma [42], indicating the important roles of HIF1A and HIF2A in tumor progression.…”