Brachyury-Related Transcription Factor Tbx2 and Repression of the Melanocyte-Specific TRP-1 Promoter

Abstract

Previous work has demonstrated that two key melanocyte-specific elements termed the MSEu and MSEi play critical roles in the expression of the melanocyte-specific tyrosinase-related protein 1 (TRP-1) promoter. Both the MSEu and MSEi, located at position ؊237 and at the initiator, respectively, bind a melanocyte-specific factor termed MSF but are also recognized by a previously uncharacterized repressor, since mutations affecting either of these elements result in strong up-regulation of TRP-1 promoter activity in melanoma cells. Here we demonstrate that repression mediated by the MSEu and MSEi also operates in melanocytes. We also report that both the MSEu and MSEi are recognized by the brachyury-related transcription factor Tbx2, a member of the recently described T-box family, and that Tbx2 is expressed in melanocyte and melanoblast cell lines but not in melanoblast precursor cells. Although Tbx2 and MSF each recognize the TRP-1 MSEu and MSEi motifs, it is binding by Tbx-2, not binding by MSF, that correlates with repression. Several lines of evidence tend to point to the brachyury-related transcription factor Tbx2 as being the repressor of TRP-1 expression: both the MSEu and MSEi bind Tbx2, and mutations in either element that result in derepression of the TRP-1 promoter diminish binding by Tbx2; the TRP-1 promoter, but not the tyrosinase, microphthalmia, or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) promoter, is repressed by Tbx2 in cotransfection assays; a high-affinity consensus brachyury/Tbx2-binding site is able to constitutively repress expression of the heterologous IE110 promoter; and a low-affinity brachyury/Tbx2 binding site is able to mediate Tbx2-dependent repression of the G3PDH promoter. Although we cannot rule out the presence of an additional, as yet unidentified factor playing a role in the negative regulation of TRP-1 in vivo, the evidence presented here suggests that Tbx2 most likely is the previously unidentified repressor of TRP-1 expression and as such is likely to represent the first example of transcriptional repression by a T-box family member.In attempting to understand how the precise temporal and spatial pattern of gene expression necessary for the development of an organism is achieved, consideration should be given not only to the question of why a specific gene is expressed in a particular cell type at any given time, but also to why it is not expressed elsewhere or at other times. Analysis of tissue-specific promoters in many cell types has revealed that they often contain binding sites for widely expressed transcription factors which may act together with factors with a more restricted tissue distribution. However, while these tissue-specific factors may be present in only a very limited number of cell types, they frequently fall into transcription factor families, members of which have identical or highly similar DNA-binding properties. For example, the CANNTG E-box motif is recognized by members of the basic helix-loop-helix (bHLH) class of transcription factors, and w...

Tbx2b is essential for neuronal differentiation along the dorsal/ventral axis of the zebrafish retina

“…It will be interesting to examine the retinas of these embryos to determine whether Tbx2 plays a similar role in asymmetrically regulating retinal neuron differentiation in mammals. In other systems, Tbx2 orthologues have been shown to function as transcriptional repressors (37,38). Whereas this function remains to be biochemically demonstrated in zebrafish, if consistent, it suggests that Tbx2b indirectly facilitates neuronal differentiation by repressing an intermediate factor that, when active, prevents neuronal differentiation in the dorsal retina.…”

Cyclic AMP a Key Messenger in the Regulation of Skin Pigmentation

“…Recently, TFE3 and TFEB have been reported to stimulate tyrosinase and TRP-1 promoter activities (62). Brachyury-related transcription factor TBX2 has been shown to inhibit TRP1 promoter activity through interaction with melanocyte-specific elements (63). The same elements also bind PAX3, a transcription factor containing an homeodomain and a paired domain, encoded by the Splotch locus (64).…”

The melanocyte inducing factor MITF is stably expressed in cell lines from human clear cell sarcoma

“…For the RT -PCR, total RNA was reverse transcribed with AMV reverse transcriptase (Boehringer, Mannheim, Germany) followed by first-strand cDNA synthesis (Amersham cDNA synthesis kit) and PCR as described previously (Carreira et al, 1998). Reverse transcription -PCR analysis of Mitf-M was performed using MITF-M forward (5 0 ATGCTGGAAATGCTAGAATATAATC3 0 ) and reverse (5 0 CAATCAGGTTGTGATTGTCC3 0 ) primers.…”