Bone morphogenetic protein signaling mediated by ALK-2 and DLX2 regulates apoptosis in glioma-initiating cells

Abstract

Bone morphogenetic protein (BMP) signaling exerts antitumor activities in glioblastoma; however, its precise mechanisms remain to be elucidated. Here, we demonstrated that the BMP type I receptor ALK-2 (encoded by the ACVR1 gene) has crucial roles in apoptosis induction of patient-derived glioma-initiating cells (GICs), TGS-01 and TGS-04. We also characterized a BMP target gene, Distal-less homeobox 2 (DLX2), and found that DLX2 promoted apoptosis and neural differentiation of GICs. The tumor-suppressive effects of ALK-2 and DLX2 were further confirmed in a mouse orthotopic transplantation model. Interestingly, valproic acid (VPA), an anti-epileptic compound, induced BMP2, BMP4, ACVR1 and DLX2 mRNA expression with a concomitant increase in phosphorylation of Smad1/5. Consistently, we showed that treatment with VPA induced apoptosis of GICs, whereas silencing of ALK-2 or DLX2 expression partially suppressed it. Our study thus reveals BMP-mediated inhibitory mechanisms for glioblastoma, which explains, at least in part, the therapeutic effects of VPA.

Cellular Effects of the Antiepileptic Drug Valproic Acid in Glioblastoma

“…These results were unexpected in light of the reported chromatin remodeling action of VPA [18, 48-50] and contradictory to previous in vitro studies [10-15, 17, 48, 51, 52] which clearly show VPA-induced cell death or radio- or chemosensitization in cancer cells including glioma. Unlike the present work, VPA concentrations of 1-5 mM [52], 1.5-2 mM [10], 1-5 mM [51], 2.5-5 mM [11], 1.5-3 mM [12], 1-15 mM [13], 2-16 mM [14], 7.5 mM [18], 2 mM [19], 5-20 mM [53], 1-10 mM [21], or 4.8 mM [22] were applied in these studies.…”

“…Beyond radio- and temozolomide sensitization, VPA-mediated histone hyperacetylation and DNA demethylation are associated with changes in cell morphology, decrease cell viability and increase apoptosis rates [14, 19, 21, 22]. Moreover, VPA treatment of glioma cells has been demonstrated to boost the adaptive immune response.…”

Tyrosine kinase Eph receptor A6 sensitizes glioma‐initiating cells towards bone morphogenetic protein‐induced apoptosis

“…Human EPHA6 (accession NP_001073917.2) was amplified by PCR. C‐terminally FLAG‐tagged full‐length human EPHA6 cDNA was cloned into an adenoviral vector (ad‐EPHA6‐WT) as previously described . The EPHA6 K757R mutant was constructed using a mutagenesis primer 5′‐GTTGCCATTAGAACTTTGAAA‐3′ and cloned into the adenoviral vector (ad‐EPHA6‐KD).…”

“…Samples were washed four times with lysis buffer and eluted in SDS‐PAGE loading buffer at 95°C for 3 minutes. Immunoblotting was carried out as previously described …”

“…The BMP family of growth factors has been proposed as potential non‐cytotoxic therapeutic agents for inhibiting the growth of GIC by inducing differentiation and sensitization to temozolomide . BMP signaling promotes the differentiation of GIC by BMP type I receptors and the intracellular signaling pathway . Moreover, our previous study showed that BMP‐4 and BMP‐7 induce apoptosis by activating the BMP type I receptor ALK‐2 .…”