Bmp4 in Zebrafish Enhances Antiviral Innate Immunity through p38 MAPK (Mitogen-Activated Protein Kinases) Pathway

Chen, Lihui; Zhong, Shenjie; Wang, Yajun; Wang, Xinyuan; Liu, Zhenhui; Hu, Guobin

doi:10.3390/ijms241914444

Cited by 1 publication

(1 citation statement)

References 49 publications

(62 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Primer F (5'-3') Primer R (5'-3') Reference atrial natriuretic peptide (nppa/anf) ACAGCTCTGACAGCAACATGG CTGATGCCTCTTCTGTTGCCA [39] beta-2-microglobulin (b2m) GCCTTCACCCCAGAGAAAGG GCGGTTGGGATTTACATGTTG [38] bone morphogenetic protein 4 (bmp4) CGCAGCCCTAAACAAAGAG TGATTGGTGGAGTTGAGATGAT [40] brain natriuretic peptide (nppb/bnp) TGTTTCGGGAGCAAACTGGA GTTCTTCTTGGGACCTGAGCG [39] cytochrome P450 26a1 (cyp26a1) GATGCTCTGGAGCACTACATTC GTTCTTGCTCGTCCGTCTTTAT [26] glutathione S-transferase p1(gstp1) CGACTTGAAAGCCACCTGTGTC CTGTCGTTTTTGCCATATGCAGC [41] retinaldehyde dehydrogenase 2 (raldh2) GGGGTAAAGTGGTAAAACGC GCAGTGGTCAAAAGCATGGC [42] t-box transcription factor 5a (tbx5a) GGAATTTAAGGCCTCACGGTA GATTTGCTGACGGCTGCATTCTGT [43] 2.6. Measurement of Glutathione Glutathione was measured in the controls and TPhP-exposed 5 dpf larvae using the Cayman Chemical Glutathione Assay Kit (item no.…”

Section: Gene Namementioning

confidence: 99%

Environmentally Relevant Concentrations of Triphenyl Phosphate (TPhP) Impact Development in Zebrafish

Schmandt,

Diduff,

Smart

et al. 2024

Toxics

View full text Add to dashboard Cite

A common flame-retardant and plasticizer, triphenyl phosphate (TPhP) is an aryl phosphate ester found in many aquatic environments at nM concentrations. Yet, most studies interrogating its toxicity have used µM concentrations. In this study, we used the model organism zebrafish (Danio rerio) to uncover the developmental impact of nM exposures to TPhP at the phenotypic and molecular levels. At concentrations of 1.5–15 nM (0.5 µg/L–5 µg/L), chronically dosed 5dpf larvae were shorter in length and had pericardial edema phenotypes that had been previously reported for exposures in the µM range. Cardiotoxicity was observed but did not present as cardiac looping defects as previously reported for µM concentrations. The RXR pathway does not seem to be involved at nM concentrations, but the tbx5a transcription factor cascade including natriuretic peptides (nppa and nppb) and bone morphogenetic protein 4 (bmp4) were dysregulated and could be contributing to the cardiac phenotypes. We also demonstrate that TPhP is a weak pro-oxidant, as it increases the oxidative stress response within hours of exposure. Overall, our data indicate that TPhP can affect animal development at environmentally relevant concentrations and its mode of action involves multiple pathways.

show abstract