Blood Digestion by Trypsin-Like Serine Proteases in the Replete Lyme Disease Vector Tick, Ixodes scapularis

Abstract

Ixodes scapularis is the major vector of Lyme disease in the Eastern United States. Each active life stage (larva, nymph, and adult) takes a blood meal either for developing and molting to the next stage (larvae and nymphs) or for oviposition (adult females). This protein-rich blood meal is the only food taken by Ixodes ticks and therefore efficient blood digestion is critical for survival. Studies in partially engorged ticks have shown that the initial stages of digestion are carried out by cathepsin proteases within acidic digestive cells. In this study, we investigated the potential role of serine proteases in blood digestion in replete ticks. RNA interference was used for functional analysis and a trypsin-benzoyl-D, L-arginine 4-nitoanilide assay was used to measure active trypsin levels. Hemoglobinolytic activity was determined in vitro, with or without a serine protease inhibitor. Our data suggest that trypsin levels increase significantly after repletion. Knockdown of serine proteases negatively impacted blood feeding, survival, fecundity, levels of active trypsin in the midgut, and resulted in lower hemoglobin degradation. Incubation of midgut extract with a trypsin inhibitor resulted in 65% lower hemoglobin degradation. We provide evidence of the serine proteases as digestive enzymes in fully engorged, replete females. Understanding the digestive profile of trypsin during blood meal digestion in I. scapularis improves our understanding of the basic biology of ticks and may lead to new methods for tick control.

RNAi by Soaking Aedes aegypti Pupae in dsRNA

“…EGFP primers were also designed with T7 promoter sequence T7EGFP_Fwd 5′TAATACGACTCACTATAGGGCCTGGTCGAGCTGGACGGCGAC3′ and T7 EGFP_Rev 5′TAATACGACTCACTATAGGGTCACGAACTCCAGCAGGACCAT3′. CYP4G35 (425 bp) and EGFP dsRNA (631 bp) were prepared following the manufacturer’s protocol (Ambion Megascript T7 in vitro transcription kit, Austin, TX, USA) and as previously described [ 7 , 21 ]. The high concentrations of dsRNA required for soaking were achieved by scaling up the in vitro transcription reaction.…”

Mialostatin, a Novel Midgut Cystatin from Ixodes ricinus Ticks: Crystal Structure and Regulation of Host Blood Digestion

“…The molecular mechanisms underlying the associated protein turnover and long-term blood meal storage in the tick gut lumen remain unexplored, mainly due to technical limitations in studying fully fed females. Nevertheless, advances in the field and initial results led to the hypothesis that off-host digestion may include extracellular proteolysis of blood proteins in the gut lumen, which supports or replaces intracellular digestive proteolysis in the gut epithelium [47]. Despite the broad biochemical selectivity of mialostatin, its biological selectivity is limited due to compartmentalization in tick midgut cells.…”

Host-specific functional compartmentalization within the oligopeptide transporter during the Borrelia burgdorferi enzootic cycle

“…The blood meal provides an abundance of proteins not just from serum but also intraluminal lysis of erythrocytes ( e . g ., hemoglobin and serum albumin) [ 60 – 62 ]. Furthermore, tick saliva contains a wide array of small peptides, which, upon re-ingestion, provide an arthropod-specific source of peptides [ 63 ].…”