Blood Clot Formation Does Not Affect Metastasis Formation or Tumor Growth in a Murine Model of Breast Cancer

Abstract

Cancer is associated with increased fracture risk, due either to metastasis or associated osteoporosis. After a fracture, blood clots form. Because proteins of the coagulation cascade and activated platelets promote cancer development, a fracture in patients with cancer often raises the question whether it is a pathologic fracture or whether the fracture itself might promote the formation of metastatic lesions. We therefore examined whether blood clot formation results in increased metastasis in a murine model of experimental breast cancer metastasis.For this purpose, a clot was surgically induced in the bone marrow of the left tibia of immundeficient mice. Either one minute prior to or five minutes after clot induction, human cancer cells were introduced in the circulation by intracardiac injection. The number of cancer cells that homed to the intervention site was determined by quantitative real-time PCR and flow cytometry. Metastasis formation and longitudinal growth were evaluated by bioluminescence imaging.The number of cancer cells that homed to the intervention site after 24 hours was similar to the number of cells in the opposite tibia that did not undergo clot induction. This effect was confirmed using two more cancer cell lines. Furthermore, no difference in the number of macroscopic lesions or their growth could be detected. In the control group 72% developed a lesion in the left tibia. In the experimental groups with clot formation 79% and 65% developed lesions in the left tibia (p = ns when comparing each experimental group with the controls). Survival was similar too.In summary, the growth factors accumulating in a clot/hematoma are neither enough to promote cancer cell homing nor support growth in an experimental model of breast cancer bone metastasis. This suggests that blood clot formation, as occurs in traumatic fractures, surgical interventions, and bruises, does not increase the risk of metastasis formation.

EDA-Fibronectin Originating from Osteoblasts Inhibits the Immune Response against Cancer

“…Intracardiac injection was performed as described [ 63 ]. Briefly, mice were anesthetized (Ketamine 120 mg/kg/xylazine 16 mg/kg).…”

A Subpopulation of Stromal Cells Controls Cancer Cell Homing to the Bone Marrow

“…Intracardiac injection was performed as described and 100,000 cells injected (27). CD34 þ cells were injected at 500,000/mouse.…”

“…Evaluation of homing of tumor cells was performed as published (27) using the resistance gene geneticine introduced in the MDA and PC3 cell line. CD34 þ stem cells were detected using human alu primers and probe: forward: 5 0 CATGGTGAAA-CCCCGTCTCTA3 0 ; reverse: 5 0 GCCTCAGCCTCCCGAGTAG3 0 ; probe: 5 0 ATTAGCCGGGCGTGGTGGCG3 0 .…”

“…We then evaluated the effect of administration of bone marrow CD45 À Sca1 þ cells on homing of cancer cells in comparison to 4 controls: untreated mice (CT), mice injected with hematopoietic CD45 þ cells, fibroblasts isolated from tumors (after depletion of immune cells and cancer cells, CAFs) or a cancer cell line that does not home to bone marrow (Huh-7; ref. 27). The number of cancer cells in bone marrow 24 hours after intracardiac administration (or 48 hours after cell transfer) was diminished when either hematopoietic CD45 þ or stromal CD45 À Sca1 þ cells were administered ( Fig.…”

Skeletal Metastases of Unknown Primary: Biological Landscape and Clinical Overview

“…[35] Nonetheless, the premetastatic niche remain elusive in the context of tumor of unknown origin. Mesenchymal stromal cells (MSCs) showed to be permissive when decreased in number pharmacologically in cancer cell homing and growth of bone metastases, Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 7 August 2019 doi:10.20944/preprints201908.0088.v1enhancing cancer cell homing to the bone marrow in mice [54]. In the complex relationship between the tumor cells the organ specific vasculature[55] and its microenvironment, an insufficient oxygen supply (hypoxia) is a prominent feature in various pathological processes, including tumor development and metastasis [56,57].…”