Blockade of T-Cell Activation by Dithiocarbamates Involves Novel Mechanisms of Inhibition of Nuclear Factor of Activated T Cells

Martı́nez-Martı́nez, Sara; Arco, Pablo Gómez del; Armesilla, Ángel Luis; Aramburu, J.; Luo, Chun; Rao, Anjana; Redondo, Juan Miguel

doi:10.1128/mcb.17.11.6437

Cited by 58 publications

(42 citation statements)

References 74 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Collectively, these results support the hypothesis that IL-2R signaling activates the NF-B pathway in NK cells and that this activation may directly or indirectly involve the transcription of the perforin gene. These two inhibitors profoundly inhibit IL-2-induced perforin expression, and PDTC may not be a selective NF-B inhibitor (37,38). Thus, it is also possible that these inhibitors inhibit other signaling pathways such as the STAT pathway.…”

Section: Perforin Gene Regulation By Il-2 In Primary Nk Cells and Thementioning

confidence: 99%

A Role for NF-κB Activation in Perforin Expression of NK Cells Upon IL-2 Receptor Signaling

Zhou

Zhang

Lichtenheld

et al. 2002

The Journal of Immunology

View full text Add to dashboard Cite

Optimal NK cell development and activation as well as cytolytic activity involves IL-2Rβ signals that also up-regulate expression of the pore-forming effector molecule perforin. Although the Jak/Stat pathway and specifically Stat5 transcription factors are required to promote many of the respective downstream events, the role of additional signaling pathways and transcription factors remains to be clarified. This report investigates the role of NF-κB activation for perforin expression by NK cells. It is demonstrated that IL-2-induced up-regulation of perforin in primary NK cells and in a model cell line is blocked by two pharmacological agents known to inhibit NF-κB activation. Direct evidence for the activation of the NF-κB pathway by IL-2R signals in NK cells involves activation of the IKKα kinase, inhibitory protein κBα degradation, nuclear translocation of p50/p65 complexes, and ultimately, transcriptional activation of the perforin gene via an NF-κB binding element in its upstream enhancer. Taken together, these observations strongly suggest that IL-2R signals can activate a pathway leading to NF-κB activation in NK cells and that this pathway is involved in the control of perforin expression.

show abstract

Section: Perforin Gene Regulation By Il-2 In Primary Nk Cells and Thementioning

confidence: 99%

A Role for NF-κB Activation in Perforin Expression of NK Cells Upon IL-2 Receptor Signaling

Zhou

Zhang

Lichtenheld

et al. 2002

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…Gel retardation assays were performed as described (47) with the only modification that in the competition experiments, the unlabeled homologous oligonucleotides were used at 80-fold molar. The sequences of the oligonucleotides (5Ј to 3Ј) used in EMSAs were tcgaGTTTAAAGAAATTCCAAAGAGTCATCAG (CD28RE/AP1 of human IL-2 promoter), gatcGGAGGAAAAACTGTTTCATACA GAAGGCGT (distal NFAT site of human IL-2 promoter), gatcATA AAATTTTCCAATGTAAA (mouse P sequence of the IL-4 promoter), and CGCTTGATGAGTCAGCCGGAA (AP1 consensus oligonucleotide).…”

Section: Emsasmentioning

confidence: 99%

HIV-1 Tat Inhibits IL-2 Gene Transcription Through Qualitative and Quantitative Alterations of the Cooperative Rel/AP1 Complex Bound to the CD28RE/AP1 Composite Element of the IL-2 Promoter

González

Punzón

González

et al. 2001

The Journal of Immunology

View full text Add to dashboard Cite

Dysregulation of cytokine secretion plays an important role in AIDS pathogenesis. Here, we demonstrate that expression of HIV-1 Tat protein in Jurkat cells induces a severe impairment of IL-2 but not TNF gene transcription. Interestingly, this inhibition correlates with the effect of the viral protein on the transactivation of the CD28RE/AP1 composite element (−164/−154), but not with that observed on the NFAT/AP1 site of the IL-2 gene promoter, neither with the effect on NF-κB- nor AP1-independent binding sites. Endogenous expression of Tat induced a decrease in the amount of the specific protein complex bound to the CD28RE/AP1 probe after PMA plus calcium ionophore stimulation. This effect was accompanied by qualitative alterations of the AP1 complex. Thus, in wild-type Jurkat cells, c-jun was absent from the complex, whereas in Tat-expressing cells, c-jun was increasingly recruited overtime. By contrast, similar amounts of c-rel and a small amount of NFAT1 were detected both in wild type and in Jurkat Tat+ cells. Furthermore, Tat not only induced the participation of c-jun in the cooperative complex but also a decrease in its transactivation activity alone or in combination with c-rel. Thus, the interaction of Tat with the components of this rel/AP1 cooperative complex seems to induce quantitative and qualitative alterations of this complex as activation progresses, resulting in a decrease of IL-2 gene transcription. Altogether our results suggest the existence of tuned mechanisms that allow the viral protein to specifically affect cooperative interactions between transcription factors.

show abstract

“…[32][33][34][35] Whereas reporter gene studies may not reflect the behavior of the endogenous genes, presently available NF-B inhibitors, such as antioxidants, radical scavengers, or proteasome inhibitors, often lack specificity. 36,37 We have, therefore, used a highly specific genetic approach of NF-B inhibition by using a recombinant adenoviral vector to study the expression of endogenous genes as well as selected functional parameters of endothelial cells.From the point of both efficiency and specificity, IKK2 appears to be an ideal target for inhibition of NF-B. It is part of the IB kinase complex that directly phosphorylates IB␣ on the aminoterminal serine residues, a key regulatory signal for the ubiquitination-dependent proteolytic degradation of IB␣ that results in liberation of NF-B from the inactive cytoplasmic complex and its translocation to the nucleus.…”

mentioning

confidence: 99%

Adenovirus-mediated expression of a mutant IκB kinase 2 inhibits the response of endothelial cells to inflammatory stimuli

Oitzinger

Hofer‐Warbinek

Schmid

et al. 2001

Blood

View full text Add to dashboard Cite

In a variety of cell types, the transcription factor nuclear factor B (NF-B) functions as a mediator of stress and immune responses. In endothelial cells (ECs), it controls the expression of genes encoding, eg, cytokines, cell adhesion molecules, and procoagulatory proteins. This study investigates the effect of NF-B suppression on several pathophysiologic functions of ECs, including inflammation, coagulation, and angiogenesis. A recombinant adenovirus was generated for expression of a dominant negative (dn) mutant of IB kinase 2 (IKK2), a kinase that acts as an upstream activator of NF-B. dnIKK2 inhibited NF-B, resulting in strongly reduced nuclear translocation and DNA binding activity of the transcription factor and lack of expression of several proinflammatory markers, including E-selectin, intercellular adhesion molecule 1, vascular cell adhesion molecule 1, and interleukin-8. Concomitantly, inhibition of leukocyte binding to dnIKK2-expressing ECs could be demonstrated in a cell adhesion assay. Furthermore, expression of tissue factor as well as the ability to form capillary tubes in a matrigel assay was impaired in dnIKK2-expressing ECs. These data demonstrate that NF-B is of central importance not only for the inflammatory response but also for a number of other EC functions. Therefore, this transcription factor as well as its upstream regulatory signaling molecules may represent favorable targets for therapeutic interference. IntroductionNuclear factor B (NF-B)/Rel transcription factors represent an ubiquitously expressed family that modulate the expression of genes involved in diverse cellular functions such as stress response, innate and adaptive immune reactions, and apoptosis. Examples include ␤-interferon, granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor, immunoglobulin light chain, interleukin-2 (IL-2), major histocompatibility complex I, T-cell receptor, A20, inhibitor of apoptosis protein (IAP), and acute phase genes (for recent reviews, see Baeuerle, 1 de Martin et al, 2 and Hatada et al 3 ). Viruses, such as human immunodeficiency virus 1 or human T-cell leukemia virus 1, use NF-B to control the transcription of their own genes and prevent their host cells from undergoing apoptosis. 4 In endothelial cells (ECs), genes dependent on NF-B include, among others, IL-1, IL-6, IL-8, E-selectin, intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), inducible nitric oxide synthase, cyclooxygenase 2, and tissue factor. In cells of the vasculature, NF-B can be activated by inflammatory cytokines, bacterial lipopolysaccharides (LPS), oxidized low-density lipoprotein (LDL), advanced glycation end products, platelet-derived growth factor, and hypoxia/reoxygenation. Several disorders that involve endothelial and smooth muscle cells, such as acute and chronic inflammation and atherogenesis, have been associated with elevated levels of NF-B.The NF-B family includes the mammalian proteins p65 (RelA), RelB, c-Rel, the viral oncogene v-Rel, ...

show abstract

Blockade of T-Cell Activation by Dithiocarbamates Involves Novel Mechanisms of Inhibition of Nuclear Factor of Activated T Cells

Cited by 58 publications

References 74 publications

A Role for NF-κB Activation in Perforin Expression of NK Cells Upon IL-2 Receptor Signaling

A Role for NF-κB Activation in Perforin Expression of NK Cells Upon IL-2 Receptor Signaling

HIV-1 Tat Inhibits IL-2 Gene Transcription Through Qualitative and Quantitative Alterations of the Cooperative Rel/AP1 Complex Bound to the CD28RE/AP1 Composite Element of the IL-2 Promoter

Adenovirus-mediated expression of a mutant IκB kinase 2 inhibits the response of endothelial cells to inflammatory stimuli

Contact Info

Product

Resources

About