Blending DNA binding dyes to improve detection in real-time PCR

Jansson, Linda; Koliana, Marianne; Sidstedt, Maja; Hedman, Jonas

doi:10.1016/j.btre.2017.02.002

Cited by 6 publications

(4 citation statements)

References 14 publications

(21 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Several molecular techniques, including nested PCR, multiplex PCR, LAMP, and realtime PCR, are used to detect soil-borne pathogens [24,25]. Real-time PCR has the advantage of having high specificity, sensitivity, and efficiency, and has become the primary method for identifying soil-borne pathogens.…”

Section: Discussionmentioning

confidence: 99%

Measuring Pathogenic Soil Fungi That Cause Sclerotinia Rot of Panax ginseng Using Real-Time Fluorescence Quantitative PCR

et al. 2023

View full text Add to dashboard Cite

Sclerotinia ginseng is the primary pathogenic fungus responsible for Sclerotinia rot of ginseng, which significantly reduces plant yield and quality. The density of sclerotia in the soil is closely associated with rot incidence and severity. Whole genome sequencing was conducted to obtain fungal frame maps. The specific primers, q2001F/q2001R, were screened out by pan-genomic analysis using the NCBI database. Recombinant plasmids containing amplicons obtained with this primer set were used as standard plasmids to construct a real-time fluorescence quantitative PCR system. The relationships between the cycle threshold (Ct) values and the soil sclerotium densities were determined by real-time PCR. Real-time PCR had a detection limit of 1.5 × 10−2 g·kg−1 soil for Sclerotinia rot causing fungal mycelium, and the relationship between the density of S. ginseng mycelium n (g·g−1 soil) and the Ct value was n = 10(40.048 − Ct)/6.9541. The detection limit of real-time PCR for measuring soil sclerotia was 3.8 × 10−5 g·g−1 soil, suggesting a sensitivity 100 times that of conventional PCR. The relationship between the sclerotium density n (g·g−1 soil) and the Ct value was n = 10(18.351 − Ct)/7.0914. Compared with the conventional PCR method, the fluorescent quantitative PCR method could detect the population of Sclerotinia spp. in soil more efficiently, accurately, and sensitively.

show abstract

Section: Discussionmentioning

confidence: 99%

Measuring Pathogenic Soil Fungi That Cause Sclerotinia Rot of Panax ginseng Using Real-Time Fluorescence Quantitative PCR

et al. 2023

View full text Add to dashboard Cite

show abstract

“…However, for some applications, it may still be preferable to apply dyes. Then, blending of qPCR dyes has been suggested to optimize detection in the presence of molecules that quench fluorescence [144]. Blending of dyes resulted in elevated fluorescence intensities, thus enabling detection of amplicons in the presence of, for example, humic acid.…”

Section: Overcoming Fluorescence Inhibitionmentioning

confidence: 99%

PCR inhibition in qPCR, dPCR and MPS—mechanisms and solutions

2020

Self Cite

View full text Add to dashboard Cite

DNA analysis has seen an incredible development in terms of instrumentation, assays and applications over the last years. Massively parallel sequencing (MPS) and digital PCR are now broadly applied in research and diagnostics, and quantitative PCR is used for more and more practises. All these techniques are based on in vitro DNA polymerization and fluorescence measurements. A major limitation for successful analysis is the various sample-related substances that interfere with the analysis, i.e. PCR inhibitors. PCR inhibition affects library preparation in MPS analysis and skews quantification in qPCR, and some inhibitors have been found to quench the fluorescence of the applied fluorophores. Here, we provide a deeper understanding of mechanisms of specific PCR inhibitors and how these impact specific analytical techniques. This background knowledge is necessary in order to take full advantage of modern DNA analysis techniques, specifically for analysis of samples with low amounts of template and high amounts of background material. The classical solution to handle PCR inhibition is to purify or dilute DNA extracts, which leads to DNA loss. Applying inhibitor-tolerant DNA polymerases, either single enzymes or blends, provides a more straightforward and powerful solution. This review includes mechanisms of specific PCR inhibitors as well as solutions to the inhibition problem in relation to cutting-edge DNA analysis.

show abstract

“…The real-time PCR method can answer the problems arising from conventional PCR because, Real-time PCR provide the amplification of the target sequence, and the amplification product can be directly observed in each cycle using a fluorescent-labeled probe (Erwanto et al, 2018). The fluorescence intensity is directly proportional to the amount of DNA reacting with fluorescent of evagreen (Jansson et al, 2017). Then the PCR products are analyzed using Melting Curve Analysis (MCA) without using agarose gel electrophoresis.…”

Section: Introductionmentioning

confidence: 99%

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

et al. 2022

View full text Add to dashboard Cite

Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.

show abstract

Blending DNA binding dyes to improve detection in real-time PCR

Cited by 6 publications

References 14 publications

Measuring Pathogenic Soil Fungi That Cause Sclerotinia Rot of Panax ginseng Using Real-Time Fluorescence Quantitative PCR

Measuring Pathogenic Soil Fungi That Cause Sclerotinia Rot of Panax ginseng Using Real-Time Fluorescence Quantitative PCR

PCR inhibition in qPCR, dPCR and MPS—mechanisms and solutions

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

Contact Info

Product

Resources

About