Bisphenol A and di(2-ethylhexyl) phthalate exert divergent effects on apoptosis and the Wnt/β-catenin pathway in zebrafish embryos: A possible mechanism of endocrine disrupting chemical action

Abstract

Polyethylene terephthalate (PET) and polycarbonate (PC) are the most commonly used plastics in water bottles. Di(2-ethylhexyl) phthalate (DEHP) is used as a plasticizer in PET plastics, and bisphenol A (BPA) is used to produce PC. Both DEHP and BPA are known for their potential endocrine disrupting effects. The Wnt/β-catenin signaling pathway has important roles in cell proliferation, cell specification and cell fate determination during embryonic development. Recent reports suggest a link between the Wnt/β-catenin signaling pathway and apoptosis. The aim of this study was to investigate the relation between Wnt/β-catenin signaling and apoptosis in the case of BPA and DEHP exposure in zebrafish embryos. Accordingly, in vivo cell death was assessed using acridine orange staining, and reverse transcription polymerase chain reaction was used to determine the expressions of wnt3a, gsk3β and ccnd1. Proliferative cell nuclear antigen, β-catenin and Wnt3a expressions were determined immunohistochemically. Vitellogenin levels were determined using Enzyme Linked ImmunoSorbent Assay (ELISA). Increased vitellogenin levels, apoptosis, and wnt3a and gsk3β expressions were observed in BPA-exposed zebrafish embryos. Increased apoptosis in the BPA-exposed embryos may be due to the pro-apoptotic changes induced by Wnt3a, whereas DEHP might be suggested to have a minor effect as Wnt3a expression; vitellogenin levels and apoptosis did not increase significantly following exposure to DEHP.

White LED Light Exposure Inhibits the Development and Xanthophore Pigmentation of Zebrafish Embryo

“…PCRs were performed using the DNA Master SYBR Green kit (Qiagen). PCRs were performed using the DNA Master SYBR Green kit (Qiagen) 51 . The expression of aanat2 (forward primer 5′-3′: AGGACGCCATCAGTGTGTTT; reverse primer 5′-3′: CTGGCCCAGGAAAACAAGTA), mtnr1ba (forward primer 5′-3′ CATTGGTCCCTGATTGGCTG; reverse primer 5′-3′ GTCCCGCCTTTTGATGTCTC) and pax7b (forward primer 5′-3′: GGAACAGTACCGCGAATGAT; reverse primer 5′-3′: GAATACACCGCCAAGCTGAT) were evaluated by quantitative RT-PCR using the Qiagen Rotor Gene-Q Light Cycler instrument.…”

Wnt pathway: A mechanism worth considering in endocrine disrupting chemical action

“…We have also investigated the relation between Wnt signaling, apoptosis, and proliferation in BPA exposed zebrafish embryos. We reported that BPA exposure led to increased vitellogenin levels, apoptosis, and gsk3β expressions in zebrafish embryos (Üstündağ et al, 2017b). Similar to the results of our study, WNT3a has been reported to induce pro-apoptotic changes in the intrinsic apoptotic pathway, including BCL2L11, BBC3, and MCL1 (Zimmerman et al, 2013).…”

“…Our group has shown that DEHP exposure led to increased mRNA levels of gsk3β in zebrafish embryos (Üstündağ et al, 2017b). We have also investigated the relationship between oxidant-antioxidant status and the Wnt/β-catenin target proto-oncogene c-myc expression in DEHP (2.5 μg/L) exposed zebrafish embryos.…”

Effects of Methacrylate Exposure on Developing Zebrafish Embryos

“…Reverse osmosis water was used for the experiments and the water was supplemented with 0.018 mg L −1 Instant Ocean™ salt. After their natural spawnings the fertilized embryos were gathered then they were cultured, and they were staged according their developmental time and morphological criteria based on the methods that were described previously (4,6). Since embryos used in this study were younger than 5 days old, no licence is needed by Council of Europe (1986), Directive 86/609/EEC or Marmara University ethics committee.…”