Biophysical and chemical handles to control the size of DNA nanoparticles produced by rolling circle amplification

Abstract

Although rolling circle amplification (RCA) is an efficient method to produce DNA materials for biomedical applications, it does not yield nano-sized products suitable for intracellular delivery. We here provide the ways to control the size of RCA products and show a potential application of the size-controlled DNA nanoparticles.

Shaping Rolling Circle Amplification Products into DNA Nanoparticles by Incorporation of Modified Nucleotides and Their Application to In Vitro and In Vivo Delivery of a Photosensitizer

“…The circular template sequence was designed to be complementary to the AS1411 aptamer sequences following the previous study [ 14 ]. The aptamer sequences forming secondary structures are known to shape the RCA products into DNPs [ 14 ].…”

“…The circular template sequence was designed to be complementary to the AS1411 aptamer sequences following the previous study [ 14 ]. The aptamer sequences forming secondary structures are known to shape the RCA products into DNPs [ 14 ]. For an additional handle to control sizes, we incorporated chemically modified nucleotides with various functional groups such as hydroxymethyl (HM), carboxylic acid (CA), allylamine (AA), propynyl (PP), propargylamine (PA), and hydroxypentynyl (HP) at the C5 position of dUTP to fine-tune the size of the resulting DNPs via electrostatic and hydrophobic interactions ( Figure 1 and Figure 2 a).…”

“…The circular template for RCA reactions was prepared following the previous report [ 14 ]. Briefly, 5′-phosphorylated linear template (Bioneer, Daejeon, Korea) (phosphate-CTCACCAGAGCCACCACCACCAACACCACCACCACCAAAAAAACCACCACCACCAACACCACCACCACCAAGTCCTGTC) (10 μM) was incubated with primer (15 μM, CTCTGGTGAGGACAGGACTT), 10× ligation buffer (1×) and T4 DNA ligase (400 units/μL) (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight.…”

“…More recently, DNA nanoparticles (DNPs) with more suitable sizes for cellular uptake (ca. 50–100 nm) could be produced by adjusting the sequences of the products and by incorporating the modified nucleotides bearing cationic amine side-chains that can interact with the phosphate backbones of polynucleotide strands [ 14 ]. Although the cellular uptake efficiency could be improved by adjusting the size and the sequence of DNPs in the previous study, it has not been investigated whether the DNPs can also be used in the in vivo environment rich in nucleases.…”

Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

“…The fraction of RNA per single particle was found to be around 20 wt %, which we anticipate to be of a similar level for the DNA-Mg-PP i particles produced in this work. Others have also shown the generation of various macromolecular nucleic acid structures that are likely to be mediated through multiple ion bridges coordinated by magnesium ions and pyrophosphate [ 41 , 42 , 43 , 44 , 45 ]. Given our results and previous reports, it is appealing to think that under certain environmental conditions, the inorganic pyrophosphate and divalent ions (magnesium, calcium, etc.)…”