Biomechanical activation of vascular endothelium as a determinant of its functional phenotype

García‐Cardeña, Guillermo; Comander, Jason; Anderson, Keith R.; Blackman, Brett R.; Gimbrone, Michael A.

doi:10.1073/pnas.071052598

Cited by 473 publications

(333 citation statements)

References 37 publications

Supporting

Mentioning

313

Contrasting

Unclassified

Order By: Relevance

“…TNF-α stimulation upregulates the expression of cell adhesion molecules (Figure 2), which are expressed in atheroprone regions and regions presenting plaque (30,38). It thus creates a dysfunctional endothelium, characterized by the expression of pro-inflammatory molecules and other ligands supporting leukocyte adhesion (39).…”

Section: Discussionmentioning

confidence: 99%

Neutrophil Adhesion on Endothelial Cells in a Novel Asymmetric Stenosis Model: Effect of Wall Shear Stress Gradients

et al. 2010

View full text Add to dashboard Cite

Leukocytes play a pivotal role in the progression of atherosclerosis. A novel three dimensional in vitro asymmetric stenosis model was used to better investigate the role of local hemodynamics in the adhesion of leukocytes to an established plaque. The adhesion of a human promyelocytic cell line (NB4) on a human abdominal aortic endothelial cell (EC) monolayer was quantified. NB4 cells were circulated over TNF-α stimulated and non-stimulated ECs for 1 or 6 hrs at 1.25 or 6.25 dynes/cm 2 and compared to static conditions. Cytokine stimulation increased significantly endothelial cell expression of intercellular adhesion molecule and vascular cell adhesion molecule. Under static conditions, neutrophils adhered overall more than under flow, with decreased adhesion with increasing shear. Adhesion was significantly higher in the recirculation region distal to the stenosis than in the inlet. Preshearing the endothelial cells decreased the expression of cell adhesion molecules in inflamed endothelium and significantly decreased adhesion. However, the ratio of adhesion between the recirculation zone and the inlet increased, hence exhibiting an increased regional difference. This work suggests an important role for neutrophil-endothelial cell interactions in the atherosclerotic process, especially in wall shear gradient regions. This is important clinically, potentially helping to explain plaque stability.

show abstract

Section: Discussionmentioning

confidence: 99%

Neutrophil Adhesion on Endothelial Cells in a Novel Asymmetric Stenosis Model: Effect of Wall Shear Stress Gradients

et al. 2010

View full text Add to dashboard Cite

show abstract

“…HUVECs are both phenotypically consistent and one of the most extensively used cell culture models for study of flow‐mediated EC signaling, including numerous studies of flow responses of the arterial system17, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 (eg, atheroprone versus atheroprotective waveforms) and DNMT1‐dependent DNA methylation 17, 18. For each set of experimental comparisons, cells were used from the same cell line between subculture passages 2 to 3.…”

Section: Methodsmentioning

confidence: 99%

“…A reaction mixture of 12.5 ng of reverse‐transcribed cDNA, DNMT1 forward primer (TGCCAGCTGAGCGTGGTGGT), DNMT1 reverse primer (GCATGCGGGCAGCCACCAAT), and FastStart SYBR Green (Roche Applied Sciences) underwent quantitative reverse transcriptase PCR on a CFX96 Real‐Time Detection System (Bio‐Rad). Expression was normalized to β2‐microglobulin (forward 5′‐AGCATTCGGGCCGAGATGTCT‐3′, reverse 5′‐CTGCTGGATGACGTGAGTAAACCT‐3′), which is endogenously expressed and is not altered by many stimuli including shear stress 36. Normalized expression was quantified using the comparative 2 ΔΔCt method.…”

Section: Methodsmentioning

confidence: 99%

DNA Methyltransferase 1–Dependent DNA Hypermethylation Constrains Arteriogenesis by Augmenting Shear Stress Set Point

Heuslein

Gorick

Song

et al. 2017

JAHA

View full text Add to dashboard Cite

BackgroundArteriogenesis is initiated by increased shear stress and is thought to continue until shear stress is returned to its original “set point.” However, the molecular mechanism(s) through which shear stress set point is established by endothelial cells (ECs) are largely unstudied. Here, we tested the hypothesis that DNA methyltransferase 1 (DNMT1)–dependent EC DNA methylation affects arteriogenic capacity via adjustments to shear stress set point.Methods and ResultsIn femoral artery ligation–operated C57BL/6 mice, collateral artery segments exposed to increased shear stress without a change in flow direction (ie, nonreversed flow) exhibited global DNA hypermethylation (increased 5‐methylcytosine staining intensity) and constrained arteriogenesis (30% less diameter growth) when compared with segments exposed to both an increase in shear stress and reversed‐flow direction. In vitro, ECs exposed to a flow waveform biomimetic of nonreversed collateral segments in vivo exhibited a 40% increase in DNMT1 expression, genome‐wide hypermethylation of gene promoters, and a DNMT1‐dependent 60% reduction in proarteriogenic monocyte adhesion compared with ECs exposed to a biomimetic reversed‐flow waveform. These results led us to test whether DNMT1 regulates arteriogenic capacity in vivo. In femoral artery ligation–operated mice, DNMT1 inhibition rescued arteriogenic capacity and returned shear stress back to its original set point in nonreversed collateral segments.ConclusionsIncreased shear stress without a change in flow direction initiates arteriogenic growth; however, it also elicits DNMT1‐dependent EC DNA hypermethylation. In turn, this diminishes mechanosensing, augments shear stress set point, and constrains the ultimate arteriogenic capacity of the vessel. This epigenetic effect could impact both endogenous collateralization and treatment of arterial occlusive diseases.

show abstract

“…For example, microarrays of ECs helped to reveal unknown signaling pathways in the endothelial immune cascades [16], specify the role of inflammatory stimuli in neutrophil transmigration [17] and identify the effects of biochemical forces [18]. Microarrays of cultured HPCs also defined detrimental components of engineered extracellular matrices [19].…”

Section: Introductionmentioning

confidence: 99%

Interleukin 32 promotes hematopoietic progenitor expansion and attenuates bone marrow cytotoxicity

Moldenhauer

Futschik

et al. 2011

Eur J Immunol

View full text Add to dashboard Cite

The identification of soluble factors involved in stem cell renewal is a major goal in the assessment of the BM niche. We have previously shown that human endothelial cell (EC) supernatants can induce the proliferation of hematopoietic progenitor cells (HPCs), especially after stimulation with IL-1b. To identify new potential growth factors, we compared the expression profile of IL-1b-stimulated ECs over 4, 8 and 16 h with non-stimulated ECs using oligonucleotide microarrays covering more than 46 000 transcripts. Most significant changes were detected after 4 h. Utilization of Gene Ontology annotation for the stimulated EC transcriptome indicated multiple upregulated genes encoding extracellular proteins with a cell-cell signaling function. Using flow cytometry, delta, colony and cobblestone assays, we assessed the proliferative capacities of 11 gene products, i.e. IL-8, IL-32, FGF-18, osteoprotegerin, Gro 1-3, ENA78, GCP-2, CCL2 and CCL20, which are not known to induce HPC expansion. Notably, IL-32 and to a lesser degree osteoprotegerin and Gro 3 significantly induced the proliferation of HPCs. Furthermore, IL-32 attenuated chemotherapy-related BM cytotoxicities by increasing the number of HPCs in mice. Our findings confirm that the combination of microarrays and gene annotation helps to identify new hematopoietic growth factors. Keywords: Endothelial cells . Hematopoietic stem cells . Molecular genetics Supporting Information available online IntroductionEndothelial cells (ECs) have been shown to support the proliferation of hematopoietic CD34 1 progenitor cells by the constitutive production of cytokines [1,2]. In previous studies, we demonstrated that ECs stimulated by TNF-a induced the generation of dendritic cells from CD34 1 cells for more than 6 wk [3]. ILs, on the other hand, can also induce the proliferation of hematopoietic and myeloid progenitors [4].So far, GM-CSF and G-CSF are known to be secreted by IL-stimulated ECs [5]. Other endothelial factors propagating progenitor expansion include stem cell factor (SCF) [6] 1774inhibitory factor (LIF) [7] and 9]. Beyond the known cytokine scenario, ECs synthesize multiple other proteins [10], i.e. chemokines of the C-X-C, C-C and TNF receptor superfamily; however, whether these factors can also support hematopoietic progenitor cell (HPC) expansion remains unknown.Notably, microarray technologies monitoring expression changes for thousands of genes have been the basis for several systematic studies of immune and stem cells and their involvement in a variety of processes [11][12][13][14][15]. For example, microarrays of ECs helped to reveal unknown signaling pathways in the endothelial immune cascades [16], specify the role of inflammatory stimuli in neutrophil transmigration [17] and identify the effects of biochemical forces [18]. Microarrays of cultured HPCs also defined detrimental components of engineered extracellular matrices [19]. To use microarrays of feeder cells for the identification of new hematopoietic growth factors is another aspect. Choong e...

show abstract

Biomechanical activation of vascular endothelium as a determinant of its functional phenotype

Cited by 473 publications

References 37 publications

Neutrophil Adhesion on Endothelial Cells in a Novel Asymmetric Stenosis Model: Effect of Wall Shear Stress Gradients

Neutrophil Adhesion on Endothelial Cells in a Novel Asymmetric Stenosis Model: Effect of Wall Shear Stress Gradients

DNA Methyltransferase 1–Dependent DNA Hypermethylation Constrains Arteriogenesis by Augmenting Shear Stress Set Point

Interleukin 32 promotes hematopoietic progenitor expansion and attenuates bone marrow cytotoxicity

Contact Info

Product

Resources

About