Biology of Developmental and Regenerative Skeletogenesis

Abstract

Embryonic skeletal development involves the recruitment, commitment, differentiation, and maturation of mesenchymal cells into those in the skeletal tissue lineage, specifically cartilage and bone along the intramembranous and endochondral ossification pathways. The exquisite control of skeletal development is regulated at the level of gene transcription, cellular signaling, cell-cell and cell-matrix interactions, as well as systemic modulation. Mediators include transcription factors, growth factors, cytokines, metabolites, hormones, and environmentally derived influences. Understanding the mechanisms underlying developmental skeletogenesis is crucial to harnessing the inherent regenerative potential of skeletal tissues for wound healing and repair, as well as for functional skeletal tissue engineering. In this review, a number of key issues are discussed concerning the current and future challenges of the scientific investigation of developmental skeletogenesis in the embryo, specifically limb cartilage development, and how these challenges relate to regenerative or reparative skeletogenesis in the adult. Specifically, a more complete understanding the biology of skeletogenic progenitor cells and the cellular and molecular mechanisms governing tissue patterning and morphogenesis should greatly facilitate the development of regenerative approaches to cartilage repair.The embryonic limb is one of the most studied developmental model systems. Many fundamental paradigms of developmental biology, including the field concept (ie, limb field), progenitor cells (ie, progress zone cells), positional information, polarity (dorsal/ventral, proximal/distal, and anterior/posterior), epithelial-mesenchymal interactions, diffusible morphogen gradients, and many others either originate from or have been amplified through their association with the biology of limb development. The fact that the skeletal primordium represents the core of the developing limb underscores the importance of the skeletal component of the early limb.The limbs develop from paired primordial buds that appear on the lateral surface of the embryo at specific levels, referred to as limb fields, along its anteriorposterior body axis (Fig 1). At the early stages of limb development, the buds exhibit a paddle shape consisting of undifferentiated mesenchymal cells derived from the lateral plate and somitic mesoderm, covered by ectoderm. The limb cartilage elements form temporally in a proximal to distal sequence, but are initially contiguous. 84 Through the gradual recruitment of cells, the primary condensation of the stylopod (humerus/femur) forms first, the zeugopod (radius-ulna/tibia-fibula) forms second, and the autopod (carpals/tarsals and phalanges) forms last. There is considerable mixing of cells along the proximal-distal axis within each future segment, but not between segments. 28 Positional information is determined in part by the expression of Hox genes. The first part of the limb, in which a subset of Hoxa and Hoxd genes are activated, is the post...

In vitro stage‐specific chondrogenesis of mesenchymal stem cells committed to chondrocytes

“…RT was performed with SuperScript III (Invitrogen) and an oligo(dT) [12][13][14][15][16][17][18] primer. Four microliters of RNA was added into a final volume of 21-l solution containing 10 mM dNTP mix, 10ϫ RT buffer, 25 mM MgCl 2 , 0.1M dithiothreitol, RNase inhibitor, and RNase H. Six microliters of RT product was used for the amplification reaction in a final volume of 50 l, containing 2.5 mM dNTP, 25 mM MgCl 2 , primers specific for each gene (for SOX9, primer 1 [P1] GGCAGCTGTGAACT-GGCCA, and P2 GCACACGGGGAACTTGTCC; for COL2A1, P1 CACGCAGAAGTTCACCAAGAA, and P2 CCTTGCTCCAGGGCCAGC; for aggrecan, P1 TGAG-GAGGGCTGGAACAAGTACC, and P2 GGAGGTGGTA-ATTGCAGGGAACA; for RUNX2, P1 ACCATGGTG-GAGATCATCGC, and P2 CATCAAGCTTCTGTCTGTGC; for ALP, P1 ACGTGGCTAAGAATGTCATC, and P2 CTG-GTAGGCGATGTCCTTA; for osteocalcin, P1 CAT-GAGAGCCCTCACA, and P2 AGAGCGACACCCTAGAC; for osteopontin, P1 CAGAATCTCCTAGCCCCACA, and P2 AACTCCTCGCTTTCCATGTG; and for GAPDH, P1 GCTCTCCAGAACATCATCCCTGCC, and P2 CGTTGT-CATACCAGGAAATGAGCTT), and Taq DNA polymerase (Invitrogen).…”

“…MSCs with the capacity to differentiate into the mesenchymal lineage can be isolated from the bone marrow (10)(11)(12), fat tissue (11), umbilical cord blood (13), and amniotic fluid (14). It has been reported that the chondrogenic abilities of MSCs could be triggered with various growth factors, including transforming growth factor ␤ (TGF␤) and fibroblast growth factor (FGF) (15,16).…”

“…During mesenchymal cell aggregation and condensation, cell-cell interactions promote cell adhesion and the release of paracrine factors (16,28,29). Mesenchymal cells subsequently transition into chondrogenesis, which is controlled by the interplay of various factors, such as hedgehog signaling pathways, transcription factors, metabolites, and stress (16,27,28).…”

Ontogeny of Skeletal Maturation in the Juvenile Rat

“…Conceptually, postnatal skeletal maturation in mammals may be considered an ex utero extension of a developmental process begun early in embryonic life (Tuan, 2004;Provot and Schipani, 2005). From the onset of chondrogenesis in the developing limb bud, the processes of endochondral elongation and endochondral ossification proceed along a nearly exponential trajectory (Goldring et al, 2006).…”

Are bone morphogenetic proteins effective inducers of cartilage repair? Ex vivo transduction of muscle‐derived stem cells

“…The initial driving force for the application of BMPs to promote cartilage and bone formation arose from the original study by Urist (8), who showed that demineralized bone implanted subcutaneously in muscle resulted in the formation of endochondral bone. Following the pioneering studies of Friedenstein and colleagues (9), who identified bone-forming progenitor cells from rat bone marrow, the capacity of MSCs to differentiate into cartilage, fat, and muscle cells, as well as bone cells, was established (10)(11)(12).…”