Biochemical characterization of the zinc-finger protein 217 transcriptional repressor complex: identification of a ZNF217 consensus recognition sequence

Abstract

Zinc-finger protein 217 (ZNF217) is a Kruppel-like zincfinger protein located at 20q13.2, within a region of recurrent maximal amplification. Here, we demonstrate that ZNF217 is a transcriptional repressor protein and report the purification and characterization of a ZNF217 complex. The purified ZNF217 complex consists of approximately six proteins and contains the transcriptional co-repressors CoREST, BHC110/LSD1, histone deacetylase (HDAC) 2 and C-terminal binding protein (CtBP1). The purified ZNF217 complex possesses deacetylase activity as well as lysine 4 histone H3-specific demethylase activity that is most likely mediated by the BHC110/LSD1 component. To determine if ZNF217 is a sequence-specific binding protein, we have made use of cyclic amplification and selection of targets (CAST) assay and identify for the first time a ZNF217 DNA consensus recognition sequence (CRS) that is highly conserved in the human E-cadherin promoter. Chromatin immunoprecipitation (ChIP) experiments demonstrate that ZNF217, as well as the other components of the ZNF217 complex, are found on the region of the proximal E-cadherin promoter that contains the identified ZNF217 CRS in vivo. Using a combination of transient transfections and small interfering RNA, we demonstrate that ZNF217 represses the E-cadherin promoter. Collectively, our results implicate ZNF217 and its associated proteins in a novel pathway that may have profound effects on cancer progression.

The Multi-zinc Finger Protein ZNF217 Contacts DNA through a Two-finger Domain

“…We began by investigating how ZNF217 might localize to the E-cadherin promoter and confirmed the previous observation that only fingers 6 and 7 detectably contact DNA (29). However, our results suggested that the E-cadherin site was bound with low affinity, prompting further mapping and mutagenesis experiments to search for higher affinity recognition sites.…”

“…To identify the domain(s) responsible for DNA recognition, we first expressed the various zinc finger clusters as GST fusion proteins in bacteria and purified them by glutathione affinity chromatography. Recent work has suggested that ZNF217 binds a particular cis-element, CAGAAC, in the human E-cadherin promoter (29). We tested various zinc finger combinations of both mouse and human ZNF217 with this element in an EMSA.…”

“…The following probe sequences were used: human E-cadherin promoter (Ϫ230 to Ϫ159), CCAGTGGAATCAGAACCGTGCAGGTCCCATAACCCA-CCTAGACCCTAGCAACTCCAGGCTAGAGGGTCACCG ( Fig. 2A), and ZNF217 site selection consensus (29), GGATC-CATTGCAGAATTGTGGTTGCTGTAGGAATTC (Fig. 2B).…”

“…ZNF217 has been recognized as an important oncogene, with overexpression of ZNF217 associated with breast, ovarian, and numerous other cancers (23)(24)(25). The mechanisms through which it operates are complex (26 -28), but one proposal has been that ZNF217 directly binds to and represses the E-cadherin gene promoter via a two-zinc finger domain that recognizes the consensus sequence CAGAAY (29). E-cadherin is an important cell adhesion molecule, and repression of E-cadherin, which presumably reduces cell-cell contacts, has been associated with cancers with increased metastatic potential (30,31).…”

A Novel 19q13 Nucleolar Zinc Finger Protein Suppresses Tumor Cell Growth through Inhibiting Ribosome Biogenesis and Inducing Apoptosis but Is Frequently Silenced in Multiple Carcinomas

“…Some ZFPs function as oncogenic proteins such as ZNF217 and ZNF639 (1,2), whereas others can act as tumor suppressors, such as ZAC, ST18, and ZNF382 (3)(4)(5). ZFPs bind to promoters with their zinc finger domains and activate or repress gene expression through their association proteins (1,6).…”