Bioaugmented Daqu-induced variation in community succession rate strengthens the interaction and metabolic function of microbiota during strong-flavor Baijiu fermentation

Mu, Yu; Huang, Jun; Zhou, Rongqing; Zhang, Suyi; Qin, Hui; Tang, Huazhong; Pan, Qianglin; Tang, Huifang

doi:10.1016/j.lwt.2023.114806

Cited by 15 publications

(4 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Biofortification involves isolating and screening functional strains using microbial isolation technology, guided by the core functional microbiota composition and traceability analysis. In situ fermentation is then applied with single or multiple strains after fermentation characterization and safety evaluation to achieve high-quality and efficient production of Baijiu [ 10 , 82 , 83 ]. Figure 1 displays the implementation of the biofortification strategy.…”

Section: Microbiota Regulation Of Baijiu Based On Functional Strains ...mentioning

confidence: 99%

“…A variety of bacterial strains were used together to enhance Baijiu fermentation. The results showed that the multi-strain enhancement did not significantly disturb the in situ microbiota of brewing and could improve Baijiu quality [ 82 , 104 ]. The ratio of strains when combining different types of strains for fortification is the key to the efficacy of fortification.…”

Section: Microbiota Regulation Of Baijiu Based On Functional Strains ...mentioning

confidence: 99%

See 1 more Smart Citation

Strategies and Challenges of Microbiota Regulation in Baijiu Brewing

Zhang,

Liu,

et al. 2024

Foods

View full text Add to dashboard Cite

The traditional Chinese Baijiu brewing process utilizes natural inoculation and open fermentation. The microbial composition and abundance in the microecology of Baijiu brewing often exhibit unstable characteristics, which directly results in fluctuations in Baijiu quality. The microbiota plays a crucial role in determining the quality of Baijiu. Analyzing the driving effect of technology and raw materials on microorganisms. Elucidating the source of core microorganisms and interactions between microorganisms, and finally utilizing single or multiple microorganisms to regulate and intensify the Baijiu fermentation process is an important way to achieve high efficiency and stability in the production of Baijiu. This paper provides a systematic review of the composition and sources of microbiota at different brewing stages. It also analyzes the relationship between raw materials, brewing processes, and brewing microbiota, as well as the steps involved in the implementation of brewing microbiota regulation strategies. In addition, this paper considers the feasibility of using Baijiu flavor as a guide for Baijiu brewing regulation by synthesizing the microbiota, and the challenges involved. This paper is a guide for flavor regulation and quality assurance of Baijiu and also suggests new research directions for regulatory strategies for other fermented foods.

show abstract

Section: Microbiota Regulation Of Baijiu Based On Functional Strains ...mentioning

confidence: 99%

Section: Microbiota Regulation Of Baijiu Based On Functional Strains ...mentioning

confidence: 99%

Strategies and Challenges of Microbiota Regulation in Baijiu Brewing

Zhang,

Liu,

et al. 2024

Foods

View full text Add to dashboard Cite

show abstract

“…For bacteria, the hypervariable region V5-V7 of the 16S rRNA gene was amplified with forward primer 799F (AACMGGATTAAGAT-ACCCKG) and reverse primer 1193R (ACGTCATCCCCACCTTCC). Meanwhile, the ITS1 region used ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATC-GATGC) primers for fungi [27]. The PCR conditions consisted of an initial step at 95 • C for 3 min, followed by 27 cycles (799F-1392R), 13 cycles (799F-1193R), and 35 cycles (ITS1F-ITS2R) of denaturation at 95 • C for 30 s, annealing at 55 • C for 30 s, and extension at 72 • C for 45 s. A final extension was conducted at 72 • C for 10 min.…”

Section: High-throughput Sequencing Analysismentioning

confidence: 99%

Interaction and Metabolic Function of Microbiota during the Washed Processing of Coffea arabica

Shen,

Wang,

et al. 2023

Molecules

View full text Add to dashboard Cite

Coffee fermentation is crucial for flavor and aroma, as microorganisms degrade mucilage and produce metabolites. This study aimed to provide a basis for understanding the impact of microorganisms on Coffea arabica from Yunnan, China, during washed processing. The microbial community structure and differentially changed metabolites (DCMs) of C. arabica beans during washed processing were analyzed. The results indicated that the top five predominant microorganisms at the genera level were Achromobacter, Tatumella, Weissella, Streptococcus, and Trichocoleus for bacteria and Cystofilobasidium, Hanseniaspora, Lachancea, Wickerhamomyces, and Aspergillus for fungi. Meanwhile, the relative content of 115 DCMs in 36 h samples decreased significantly, compared to non-fermentation coffee samples (VIP > 1, p < 0.05, FC < 0.65), and the relative content of 28 DCMs increased significantly (VIP > 1, p < 0.05, FC > 1.5). Furthermore, 17 DCMs showed a strong positive correlation with microorganisms, and 5 DCMs had a strong negative correlation (p < 0.05, |r| > 0.6). Therefore, the interaction and metabolic function of microbiota play a key role in the formation of coffee flavor, and these results help in clarifying the fermentation mechanisms of C. arabica and in controlling and improving the quality of coffee flavor.

show abstract

“…It was found that BF of Daqu by inoculating Bacillus spp. had a positive effect on the microbiome and metabolome, especially the former, in the process of Baijiu fermentation [14,15]. Both the flavor intensity and the sensory quality of Baijiu have been significantly improved by BF inoculation with Saccharomyces cerevisiae [16].…”

Section: Introductionmentioning

confidence: 95%

Interaction and Metabolic Function of Microbiota during Tibetan Tea Fermentation through Bioaugmentation with Aspergillus niger

et al. 2023

View full text Add to dashboard Cite

Developing an effective method to achieve stability and improve the quality of Tibetan tea has scientific significance. Aspergillus niger K1 isolated and identified from Tibetan tea was inoculated in unsterilized or sterilized tea leaves to develop the bioaugmented fermentation (BF) and normal fermentation (NF) processes of Tibetan tea. The results showed that BF resulted in infusions with a deeper color, a stronger aroma, and a thicker taste compared to NF. The dominant bacterium in BF was Staphylococcus (23.76%), while the dominant fungus was Blastobotrys adeninivorans (50.95%). Moreover, 859 metabolites were identified, and the level of 90 differentially changed metabolites (DCMs) in BF increased significantly (VIP > 1, p < 0.05, FC > 2) compared to those in NF, while the level of 37 DCMs in BF decreased significantly (VIP > 1, p < 0.05, FC < 0.5). Correlation analysis demonstrated that A. niger significantly positively correlated with theabrownins, caffeine, and glutamylisoleucine (p < 0.05, |r| > 0.8). B. adeninivorans showed significant negative correlations with 1-(beta-D-ribofuranosyl)-1,4-dihydronicotinamide and 2-hydroxyacetaminophen sulfate (p < 0.05, |r| > 0.8). Consequently, the inoculation of A. niger for BF has the potential to alter the metabolites in tea through a synergistic interaction with other microorganisms, ultimately improving the sensory quality of Tibetan tea.

show abstract

Bioaugmented Daqu-induced variation in community succession rate strengthens the interaction and metabolic function of microbiota during strong-flavor Baijiu fermentation

Cited by 15 publications

References 41 publications

Strategies and Challenges of Microbiota Regulation in Baijiu Brewing

Strategies and Challenges of Microbiota Regulation in Baijiu Brewing

Interaction and Metabolic Function of Microbiota during the Washed Processing of Coffea arabica

Interaction and Metabolic Function of Microbiota during Tibetan Tea Fermentation through Bioaugmentation with Aspergillus niger

Contact Info

Product

Resources

About