Binding site of MraZ transcription factor in Mollicutes

Fisunov, Gleb Y.; Evsyutina, Daria V.; Semashko, Tatiana A.; Arzamasov, Aleksandr A.; Manuvera, Valentin A.; Letarov, Andrey V.; Govorun, Vadim M.

doi:10.1016/j.biochi.2016.02.016

Cited by 26 publications

(38 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The two others most likely control important but as yet unknown functions. The binding sites of HrcA (Chang et al, 2008) and MraZ (Fisunov et al, 2016) in Mollicutes are known and are highly conserved. The binding site of the YebC/PmpR-family TF was found in A. laidlawii and controls inorganic pyrophosphatase and genes with unknown function.…”

Section: Resultsmentioning

confidence: 99%

“…MraZ is conserved in spiroplasmas and mycoplasmas, whereas WhiA is conserved in all Mollicutes. The role of MraZ is more or less known (Fisunov et al, 2016) and appears to be widespread in Bacteria (Eraso et al, 2014); the function of WhiA as a cell division regulator was demonstrated only for Streptomyces coelicolor (Jakimowicz et al, 2006). In this bacterium, the WhiA-family TF was shown to regulate parAB and ftsZ genes.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Reconstruction of Transcription Control Networks in Mollicutes by High-Throughput Identification of Promoters

et al. 2016

View full text Add to dashboard Cite

Bacteria of the class Mollicutes have significantly reduced genomes and gene expression control systems. They are also efficient pathogens that can colonize a broad range of hosts including plants and animals. Despite their simplicity, Mollicutes demonstrate complex transcriptional responses to various conditions, which contradicts their reduction in gene expression regulation mechanisms. We analyzed the conservation and distribution of transcription regulators across the 50 Mollicutes species. The majority of the transcription factors regulate transport and metabolism, and there are four transcription factors that demonstrate significant conservation across the analyzed bacteria. These factors include repressors of chaperone HrcA, cell cycle regulator MraZ and two regulators with unclear function from the WhiA and YebC/PmpR families. We then used three representative species of the major clades of Mollicutes (Acholeplasma laidlawii, Spiroplasma melliferum, and Mycoplasma gallisepticum) to perform promoter mapping and activity quantitation. We revealed that Mollicutes evolved towards a promoter architecture simplification that correlates with a diminishing role of transcription regulation and an increase in transcriptional noise. Using the identified operons structure and a comparative genomics approach, we reconstructed the transcription control networks for these three species. The organization of the networks reflects the adaptation of bacteria to specific conditions and hosts.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Reconstruction of Transcription Control Networks in Mollicutes by High-Throughput Identification of Promoters

et al. 2016

View full text Add to dashboard Cite

show abstract

“…gallisepticum adaptation to various exposures using non-targeted mutagenesis of genes responsible for terpenoid synthesis in M . gallisepticum 38 . Mutant M .…”

Section: Discussionmentioning

confidence: 99%

Response induced in Mycoplasma gallisepticum under heat shock might be relevant to infection process

Butenko

Vanyushkina

Pobeguts

et al. 2017

Sci Rep

View full text Add to dashboard Cite

Despite the fact the term “proteome” was proposed to characterize a set of proteins in one of mycoplasma species, proteome response to various exposures in this bacteria are still obscure. Commonly, authors studying proteomic response on perturbation models in mycoplasmas use single approach and do not confirm their findings by alternative methods. Consequently, the results of proteomic analysis should be validated by complementary techniques. In this study we utilized three complementary approaches (SWATH, MRM, 2D-DIGE) to assess response of Mycoplasma gallisepticum under heat stress on proteomic level and combined these findings with metabolic response and the results of transcriptional profiling. We divide response into two modes – one is directly related to heat stress and other is triggered during heat stress, but not directly relevant to it. The latter includes accumulation of ATP and shedding of antigens. Both of these phenomena may be relevant to evasion of host’s immune system and dissemination during mycoplasmosis in vivo.

show abstract

“…Cloning and purification procedures were performed as described in [ 12 ]. The HsdC (GCW_02350) coding sequence was amplified from the genomic DNA of M. gallisepticum S6 (forward primer: ATTAGGATCC ATGTTTGATTATGCAAAGAAAATTA, reverse primer: TATAGTCGAC ATCATCTAATTTCATGCCAATCT, sequences for cloning are underlined).…”

Section: Methodsmentioning

confidence: 99%

“…The HsdC (GCW_02350) coding sequence was amplified from the genomic DNA of M. gallisepticum S6 (forward primer: ATTAGGATCC ATGTTTGATTATGCAAAGAAAATTA, reverse primer: TATAGTCGAC ATCATCTAATTTCATGCCAATCT, sequences for cloning are underlined). The amplicon was cloned into the pETm plasmid with C-terminal His-tag as described previously [ 12 ]. HsdC protein was produced in E. coli BL21-Gold (DE3) cells.…”

Section: Methodsmentioning

confidence: 99%

Binding site of restriction-modification system controller protein in Mollicutes

et al. 2017

View full text Add to dashboard Cite

BackgroundBacteria of the class Mollicutes underwent extreme reduction of genomes and gene expression control systems. Only a few regulators are known to date. In this work, we describe a novel group of transcriptional regulators that are distributed within different Mollicutes and control the expression of restriction-modification systems (RM-systems).ResultsWe performed cross-species search of putative regulators of RM-systems (C-proteins) and respective binding sites in Mollicutes. We identified a set of novel putative C-protein binding motifs distributed within Mollicutes. We studied the most frequent motif and respective C-protein on the model of Mycoplasma gallisepticum S6. We confirmed our prediction and identified key nucleotides important for C-protein binding. Further we identified novel target promoters of C-protein in M. gallisepticum.ConclusionsWe found that C-protein of M. gallisepticum binds predicted conserved direct repeats of the (GTGTTAN5)2 motif. Apart from its own operon promoter, HsdC can bind to the promoters of the clpB chaperone gene and a tRNA cluster.Electronic supplementary materialThe online version of this article (doi:10.1186/s12866-017-0935-4) contains supplementary material, which is available to authorized users.

show abstract

Binding site of MraZ transcription factor in Mollicutes

Cited by 26 publications

References 17 publications

Reconstruction of Transcription Control Networks in Mollicutes by High-Throughput Identification of Promoters

Reconstruction of Transcription Control Networks in Mollicutes by High-Throughput Identification of Promoters

Response induced in Mycoplasma gallisepticum under heat shock might be relevant to infection process

Binding site of restriction-modification system controller protein in Mollicutes

Contact Info

Product

Resources

About