Bile acid-FXRα pathways regulate male sexual maturation in mice

Baptissart, Marine; Martinot, Emmanuelle; Véga, Anne; Sédes, Lauriane; Rouaisnel, Betty; Haze, Angélique De; Baron, Silvère; Schoonjans, Kristina; Caira, Françoise; Volle, David H.

doi:10.18632/oncotarget.7153

Cited by 25 publications

(29 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As Fxrα is expressed in different cell types of the testis, we used a full-knockout model (Baptissart et al., 2016). During aging, more Fxrα −/− males remained fertile than wild-type (WT) (Figure 1A).…”

Section: Resultsmentioning

confidence: 99%

The Bile Acid Nuclear Receptor FXRα Is a Critical Regulator of Mouse Germ Cell Fate

et al. 2017

Self Cite

View full text Add to dashboard Cite

SummarySpermatogenesis is the process by which spermatozoa are generated from spermatogonia. This cell population is heterogeneous, with self-renewing spermatogonial stem cells (SSCs) and progenitor spermatogonia that will continue on a path of differentiation. Only SSCs have the ability to regenerate and sustain spermatogenesis. This makes the testis a good model to investigate stem cell biology. The Farnesoid X Receptor alpha (FXRα) was recently shown to be expressed in the testis. However, its global impact on germ cell homeostasis has not yet been studied. Here, using a phenotyping approach in Fxrα−/− mice, we describe unexpected roles of FXRα on germ cell physiology independent of its effects on somatic cells. FXRα helps establish and maintain an undifferentiated germ cell pool and in turn influences male fertility. FXRα regulates the expression of several pluripotency factors. Among these, in vitro approaches show that FXRα controls the expression of the pluripotency marker Lin28 in the germ cells.

show abstract

Section: Resultsmentioning

confidence: 99%

The Bile Acid Nuclear Receptor FXRα Is a Critical Regulator of Mouse Germ Cell Fate

et al. 2017

Self Cite

View full text Add to dashboard Cite

show abstract

“…Murine spermiogenesis is divided into the following four phases based on sharp nuclear condensation: round spermatids, elongating spermatids, condensing spermatids and condensed spermatids [ 11 ]. For many decades, Leydig cells have been known to produce testosterone to support spermatogenesis [ 12 , 13 ]. Testosterone levels in the adult testis are maintained at a relatively stable and high level (200–800 nM) [ 10 ].The testosterone levels and Leydig cell functions in NMRs remain largely unexplored.…”

Section: Introductionmentioning

confidence: 99%

Levels of Leydig cell autophagy regulate the fertility of male naked mole-rats

Yang

Huang

et al. 2017

Oncotarget

View full text Add to dashboard Cite

Fertility is abolished in nonbreeding males in colonies of natal naked mole-rats (NMRs). Although spermatogenesis occurs in both breeding and nonbreeding male NMRs, the mechanisms underlying the differences in fertility between breeders and nonbreeders remain unexplored. In this study, a significant decrease in autophagy was observed in Leydig cells of the testis from nonbreeding male NMRs. This alteration was visualised as a significant decrease in the levels of autophagy-related gene 7 (Atg7), Atg5, microtubule-associated protein 1A/B light chain 3 (LC3-II/I) and the number of autophagosomes and an increase in P62 levels using Western blotting analyses. Furthermore, monodansylcadaverine (MDC) staining and Western blot analyses revealed that testosterone production decreased in nonbreeding male NMR Leydig cells, this decrease was associated with a reduction in autophagy. Primary Leydig cells from breeding and nonbreeding male NMRs were processed to investigate the effect of an autophagy inhibitor (3-MA, 3-methyladenine) or an autophagy activator (rapamycin) on testosterone production. Rapamycin induced an increase in testosterone production in NMR Leydig cells, whereas 3-MA had the opposite effect. Consequently, spermatogenesis, the weight of the testis, and androgen levels were dramatically reduced in nonbreeding male NMRs. While rapamycin treatment restored the fertility of nonbreeding male NMRs. Based on these results, inadequate autophagy correlates with a decrease in steroid production in nonbreeding male NMR Leydig cells, which may ultimately influence the spermatogenesis and fertilities of these animals.

show abstract

“…A remaining question will be to define the endogenous/physiological ligand(s) of FXRα within the testis. Evidence was previously given that, under physiological conditions, there are detectable levels of BA and that testis can synthetized bile acids ( Baptissart et al., 2014 , Baptissart et al., 2016 , Martinot et al., 2017b , Vega et al., 2015 ). In addition, previous reports demonstrate that steroids such as androsterone could be physiological ligands of FXRα ( Wang et al., 2006 ).…”

Section: Discussionmentioning

confidence: 99%

“…Fxrα −/– mice are described elsewhere ( Baptissart et al., 2016 , Martinot et al., 2017b , Martinot et al., 2017a ). The mice used in this study were housed in a temperature-controlled rooms with 12-hr light/dark cycles.…”

Section: Methodsmentioning

confidence: 99%

“…The results were analyzed using the ΔΔct method. Some of the primers were used in previous studies: Plzf , Nanog , Lin28 , Osp , Fshr , Fxrα ( Martinot et al., 2017a ), Stra8 , Dmc1 ( Martinot et al., 2017b ), Pxr (44), Sycp3 ( Volle et al., 2007 ), Cyp26b1 , Shp , Esr1 , Esr2 ( Volle et al., 2009 ), Bsep, G 6Pase , Pepck , Apoa1 ( Vega et al., 2014 ), Dax1 ( Baptissart et al., 2016 ), and Dnmt3L (fw GACGGAGCATTGAAGACATCT rv CACATAACCCTCCCTCAAACCA).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Crosstalk between BPA and FXRα Signaling Pathways Lead to Alterations of Undifferentiated Germ Cell Homeostasis and Male Fertility Disorders

et al. 2018

Self Cite

View full text Add to dashboard Cite

SummarySeveral studies have reported an association between the farnesoid X receptor alpha (FXRα) and estrogenic signaling pathways. Fxrα could thus be involved in the reprotoxic effects of endocrine disruptors such as bisphenol-A (BPA). To test this hypothesis, mice were exposed to BPA and/or stigmasterol (S), an FXRα antagonist. Following the exposure to both molecules, wild-type animals showed impaired fertility and lower sperm cell production associated with the alteration of the establishment and maintenance of the undifferentiated germ cell pool. The crosstalk between BPA and FXRα is further supported by the lower impact of BPA in mice genetically ablated for Fxrα and the fact that BPA counteracted the effects of FXRα agonists. These effects might result from the downregulation of Fxrα expression following BPA exposure. BPA and S act additively in human testis. Our data demonstrate that FXRα activity modulates the impact of BPA on male gonads and on undifferentiated germ cell population.

show abstract

Bile acid-FXRα pathways regulate male sexual maturation in mice

Cited by 25 publications

References 30 publications

The Bile Acid Nuclear Receptor FXRα Is a Critical Regulator of Mouse Germ Cell Fate

The Bile Acid Nuclear Receptor FXRα Is a Critical Regulator of Mouse Germ Cell Fate

Levels of Leydig cell autophagy regulate the fertility of male naked mole-rats

Crosstalk between BPA and FXRα Signaling Pathways Lead to Alterations of Undifferentiated Germ Cell Homeostasis and Male Fertility Disorders

Contact Info

Product

Resources

About