Biased 16S rDNA PCR amplification caused by interference from DNA flanking the template region

Hansen, Michael Sass

doi:10.1016/s0168-6496(98)00031-2

Cited by 65 publications

(84 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…DNA was extracted using the Masterpure complete DNA and RNA purification kit (Epicentre, Leusden, The Netherlands) as recommended with the following modification: 1 μl Ready-lyse lysozyme solution (Epicentre, Leusden, The Netherlands) was added to 150 μl sample followed by incubation at 37 °C for 30 minutes prior to the extraction. Primers V345_341F (CCT ACG GGR SGC AGC AG) and V345_909R (TTT CAG YCT TGC GRC CGT AC) were used for 16S amplification of the V3–V5 region and primers (ITS-F3): GCATCGATGAAGAACGCAGC and (ITS-R4): TCCTCCGCTTATTGATATGC for amplifying the fungal ITS-II region using multiplexed Roche 454 pyrosequencing404142. Samples were purified by bead-beating prior to amplification.…”

Section: Methodsmentioning

confidence: 99%

The endotracheal tube microbiome associated with Pseudomonas aeruginosa or Staphylococcus epidermidis

Hotterbeekx

Xavier

Bielen

et al. 2016

Sci Rep

View full text Add to dashboard Cite

Ventilator-associated pneumonia (VAP) is one of the commonest hospital-acquired infections associated with high mortality. VAP pathogenesis is closely linked to organisms colonizing the endotracheal tube (ETT) such as Staphylococcus epidermidis and Pseudomonas aeruginosa, the former a common commensal with pathogenic potential and the latter a known VAP pathogen. However, recent gut microbiome studies show that pathogens rarely function alone. Hence, we determined the ETT microbial consortium co-colonizing with S. epidermidis or P. aeruginosa to understand its importance in the development of VAP and for patient prognosis. Using bacterial 16S rRNA and fungal ITS-II sequencing on ETT biomass showing presence of P. aeruginosa and/or S. epidermidis on culture, we found that presence of P. aeruginosa correlated inversely with patient survival and with bacterial species diversity. A decision tree, using 16S rRNA and patient parameters, to predict patient survival was generated. Patients with a relative abundance of Pseudomonadaceae <4.6% and of Staphylococcaceae <70.8% had the highest chance of survival. When Pseudomonadaceae were >4.6%, age of patient <66.5 years was the most important predictor of patient survival. These data indicate that the composition of the ETT microbiome correlates with patient prognosis, and presence of P. aeruginosa is an important predictor of patient outcome.

show abstract

Section: Methodsmentioning

confidence: 99%

The endotracheal tube microbiome associated with Pseudomonas aeruginosa or Staphylococcus epidermidis

Hotterbeekx

Xavier

Bielen

et al. 2016

Sci Rep

View full text Add to dashboard Cite

show abstract

“…However, the influence of GC content or melting temperature on the amplification efficiency was not significant. Therefore, other possible explanations for sequence-specific variability of amplification efficiencies such as the formation of different secondary structures of target sequences or amplicons that may affect primer accessibility or elongation efficiency during PCR may apply (Hansen et al, 1998).…”

Section: Differences In Amplification Efficienciesmentioning

confidence: 99%

Reliability for detecting composition and changes of microbial communities by T-RFLP genetic profiling

Hartmann

Widmer

2008

FEMS Microbiology Ecology

View full text Add to dashboard Cite

Terminal restriction fragment length polymorphism (T-RFLP) analysis is commonly used for profiling microbial communities in various environments. However, it may suffer from biases during the analytic process. This study addressed the potential of T-RFLP profiles (1) to reflect real community structures and diversities, as well as (2) to reliably detect changing components of microbial community structures. For this purpose, defined artificial communities of 30 SSU rRNA gene clones, derived from nine bacterial phyla, were used. PCR amplification efficiency was one primary bias with a maximum variability factor of 3.5 among clones. PCR downstream analyses such as enzymatic restriction and capillary electrophoresis introduced a maximum bias factor of 4 to terminal restriction fragment (T-RF) signal intensities, resulting in a total maximum bias factor of 14 in the final T-RFLP profiles. In addition, the quotient between amplification efficiency and T-RF size allowed predicting T-RF abundances in the profiles with high accuracy. Although these biases impaired detection of real community structures, the relative changes in structures and diversities were reliably reflected in the T-RFLP profiles. These data support the suitability of T-RFLP profiling for monitoring effects on microbial communities.

show abstract

“…Burton Lake and Taynaya Bay are both in¯uenced by a tidal in¯ux of sea water, undergo seasonal changes in trophic level complexity (Vincent, 1988), have the lowest sediment temperatures (Table 1) and have oxic/anoxic boundaries that can change in depth. Although these differences are interesting, the lack of comparative data and the methodological limitations of PCR-based environmental 16S rDNA-based studies (Hansen et al, 1998) limit the possibilities of interpretation. More samples and implementation of quantitative experiments are required to ascertain further the succession of prokaryotic taxa across Vestfold Hills meromictic basins.…”

Section: Comparisons Between the Sediment Clone Librariesmentioning

confidence: 99%

Diversity and community structure within anoxic sediment from marine salinity meromictic lakes and a coastal meromictic marine basin, Vestfold Hills, Eastern Antarctica

Bowman

Rea

McCammon³

et al. 2000

Environmental Microbiology

166

110

View full text Add to dashboard Cite

16S rDNA clone library analysis was used to examine the biodiversity and community structure within anoxic sediments of several marine-type salinity meromictic lakes and a coastal marine basin located in the Vestfolds Hills area of Eastern Antarctica. From 69 to 130 (555 total) 16S rDNA clones were analysed from each sediment sample, and restriction fragment length polymorphism (RFLP) and sequence analysis grouped the clones into 202 distinct phylotypes (a clone group with sequence similarity of >0.98). A number of phylotypes and phylotype groups predominated in all libraries, with a group of 10 phylotypes (31% of clones) forming a novel deep branch within the low G+C Gram-positive division. Other abundant phylotypes detected in several different clone libraries grouped with Prochlorococcus cyanobacteria, diatom chloroplasts, delta proteobacteria (Desulfosarcina group, Syntrophus and Geobacterl Pelobacter/Desulphuromonas group), order Chlamydiales (Parachlamydiaceae) and Spirochaetales (wall-less Antarctic spirochaetes). Most archaeal clones detected (3.1% of clones) belonged to a highly diverged group of Euryarchaeota clustering with clones previously detected in rice soil, aquifer sediments and hydrothermal vent material. Little similarity existed between the phylotypes detected in this study and other clone libraries based on marine sediment, suggesting that an enormous prokaryotic diversity occurs within marine and marine-derived sediments.

show abstract

Biased 16S rDNA PCR amplification caused by interference from DNA flanking the template region

Cited by 65 publications

References 12 publications

The endotracheal tube microbiome associated with Pseudomonas aeruginosa or Staphylococcus epidermidis

The endotracheal tube microbiome associated with Pseudomonas aeruginosa or Staphylococcus epidermidis

Reliability for detecting composition and changes of microbial communities by T-RFLP genetic profiling

Diversity and community structure within anoxic sediment from marine salinity meromictic lakes and a coastal meromictic marine basin, Vestfold Hills, Eastern Antarctica

Contact Info

Product

Resources

About