Bfl-1/A1 acts as a negative regulator of autophagy in mycobacteria infected macrophages

Kathania, Mahesh; Raje, Chaaya Iyengar; Raje, Manoj; Dutta, Rajesh Kumar; Majumdar, S.

doi:10.1016/j.biocel.2010.12.014

Cited by 34 publications

(22 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RT-PCR was carried out in a volume of 20 l using Access RT-PCR system (promega) according to manufacturer's instructions. The primer sequences for gp130 were sense: 5 CATGCTTTGGGTGGAATGGAC3 ; antisense: 5 CATCAACAGGAAG-TTGGTCCC3 (Shimon et al, 1997); WSX-1, sense: 5 TGGACTT-TTCCGAGGATGAC3 ; antisense: 5 GGAGCAGCAGCAGGTAATTC3 (Shimizu et al, 2006); ␤-actin, sense: 5 AAGAGAGGCATCCTCA-CCC3 ; antisense: 5 TACATGGCTGGGGTGTTGAA3 (Kathania et al, 2011).…”

Section: Rt-pcr Analysismentioning

confidence: 99%

“…RFP-LC3-THP-1 cells were infected with GFP-M. tuberculosis H37Rv as described previously (Kathania et al, 2011) and then incubated in the presence or absence of IFN-␥ (200 U/ml) or IL-27 (50 ng/ml) either alone or together for 4 h. After incubation cells were examined for co-localization with LC3 positive autophagosomes under confocal microscope. Phagosome-lysosome fusion was seen by LysoTracker staining as described previously (Kathania et al, 2011).…”

Section: Autophagy Induction In Mycobacterial Infection By Ifn-in Thp-1mentioning

confidence: 99%

“…THP-1 cell line was obtained from European Collection of Animal Cell Culture and processed for experiments as described earlier (Kathania et al, 2011). All cell culture reagents were purchased from Gibco Laboratories.…”

Section: Cell Culture and Reagentsmentioning

confidence: 99%

See 2 more Smart Citations

IL-27 inhibits IFN-γ induced autophagy by concomitant induction of JAK/PI3 K/Akt/mTOR cascade and up-regulation of Mcl-1 in Mycobacterium tuberculosis H37Rv infected macrophages

Sharma

Dutta

Khan

et al. 2014

The International Journal of Biochemistry & Cell Biology

Self Cite

View full text Add to dashboard Cite

Section: Rt-pcr Analysismentioning

confidence: 99%

Section: Autophagy Induction In Mycobacterial Infection By Ifn-in Thp-1mentioning

confidence: 99%

See 1 more Smart Citation

IL-27 inhibits IFN-γ induced autophagy by concomitant induction of JAK/PI3 K/Akt/mTOR cascade and up-regulation of Mcl-1 in Mycobacterium tuberculosis H37Rv infected macrophages

Sharma

Dutta

Khan

et al. 2014

The International Journal of Biochemistry & Cell Biology

Self Cite

View full text Add to dashboard Cite

“…T-cells also express Bfl-1 in a developmentally regulated manner 381 , and Bfl-1 is induced during macrophage and lymphocyte activation 376,382 and in human coronary artery smooth muscle cells under high glucose conditions 383 . Bfl-1 has also been observed to bind beclin-1, and was hence seen to play a role in the inhibition of autophagy in mycobacterium infected macrophages 384 .…”

Section: The Role Of Bfl-1 In Healthy Tissuesmentioning

confidence: 99%

Role of the pro-survival molecule Bfl-1 in melanoma

Hind

Carter

Harris

et al. 2015

The International Journal of Biochemistry & Cell Biology

View full text Add to dashboard Cite

Melanoma, the cancer derived from the melanocytes of the skin, is becoming an ever more common cancer in the ageing population of the developed world and displays an intrinsic resistance to current therapies. This chemo resistance makes metastatic melanoma an extremely difficult cancer to treat leading to a 5 year survival rate of just 20%. As such, it is important to unearth new potential drug targets to increase the prospects for melanoma patients.Bfl-1 is a pro-survival protein of the Bcl-2 family of apoptosis regulating proteins. It has been found to be over-expressed in a small subset of chemo resistant tumours, including melanoma. Accordingly, I characterised the molecule in melanoma cells and determined its role in protecting these cells from chemotherapy-induced apoptosis. I elucidated the expression profile and half-lives of the protein and mRNA across a panel of melanoma cell-lines and healthy melanocytes. I also confirmed, using pathway specific inhibitors, that Bfl-1 was transcriptionally regulated by the NFB pathway and concluded through pulsechase experiments that Bfl-1 protein was degraded, at least in part, by the proteasome. Subcellular fractionation and indirect immunofluorescence techniques elucidated that Bfl-1 was located mostly at the mitochondria in both resting and apoptotic cells, with a diffuse level present throughout the cytoplasm. As well as characterising the protein in both melanoma cells and healthy primary melanocytes, I determined its role in the resistance of these cells to apoptosis. Over-expressed Bfl-1 was found to protect melanoma cells from apoptosis caused by a range of chemotherapeutic agents in A375 melanoma cells, which naturally expressed very low levels of Bfl-1. Further, knock down of Bfl-1 using siRNA technology in melanoma cells revealed the dependence of these cells on Bfl-1 for their resistance to certain chemotherapeutic agents currently used in melanoma treatment, including the MEK inhibitor PD901. All together, this research contributes to our understanding of Bfl-1 and highlights it as a potentially important therapeutic target in metastatic melanoma.

show abstract

“…24 HA-tagged overexpressed BCL2A1 also interacts with the BH3-like protein Beclin-1, thus potentially contributing to inhibition of autophagy. 25 In addition, an interaction of BCL2A1 with Nur77-derived BCL2-converting peptide with nine amino acids (NuBCP-9) has been described. In that study, NuBCP-9 converted BCL2 into a pro-apoptotic molecule by binding to its loop region, which resulted in exposure of the BCL2 BH3 domain.…”

Section: Interaction Partners Of Bcl2a1mentioning

confidence: 99%