[beta]-Tubulin, ITS and Group I Intron Sequences Challenge the Species Pair Concept in Physcia aipolia and P. caesia

Myllys, Leena; Lohtander, Katileena; Tehler, Anders

doi:10.2307/3761655

Cited by 95 publications

(61 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These results suggests a strong geographical structure in the L. retigera lineage, among the populations in Canada, Madagascar, Bhutan, Yunnan (China), and Sakhalin (Russia), of this widely distributed taxon. It is likely that these isolated populations have evolved over geologically long periods, and, independent of their reproductive mode and taxonomic rank, these geographically differentiated clades may deserve the status of evolutionarily significant units (Moritz 1995) (Lohtander et al 1998a, b;Myllys et al 1999;Myllys et al 2001), our study of L. retigera shows that apotheciate clades have developed repeatedly from rarely fertile, isidiate morphs. In contrast to Poelt's (1972) hypothesis of species pairs, published studies reveal transitions from isidiate morphs that have the potential to form apothecia rarely, towards apotheciate morphs that produce no vegetative propagules.…”

Section: Discussionmentioning

confidence: 66%

Phylogenetic analysis indicates transitions from vegetative to sexual reproduction in theLobaria retigeragroup (Lecanoromycetidae, Ascomycota)

Cornejo¹,

Chabanenko

Scheidegger³

2009

The Lichenologist

View full text Add to dashboard Cite

Phylogenetic relationships among the hypothetical species pairs Lobaria kurokawae / L. retigera and L. pseudopulmonaria / L. isidiosa were investigated based on TLC techniques and the phylogenetic analysis of the internal transcribed spacers (ITS) nrDNA. Results of TLC demonstrate that L. retigera and L. kurokawae can be chemically distinguished from L. isidiosa and L. pseudopulmonaria by the absence of retigeranic acid. Parsimony analysis of 18 specimens shows two monophyletic clades -a L. retigera lineage and a L. isidiosa lineage-both including their apotheciate counterparts. Unlike the original hypothesis of species pairs, our study reveals transitions from isidiate morphs that have the potential to rarely form apothecia, towards apotheciate morphs that produce no vegetative propagules.

show abstract

Section: Discussionmentioning

confidence: 66%

Phylogenetic analysis indicates transitions from vegetative to sexual reproduction in theLobaria retigeragroup (Lecanoromycetidae, Ascomycota)

Cornejo¹,

Chabanenko

Scheidegger³

2009

The Lichenologist

View full text Add to dashboard Cite

show abstract

“…We used the primers Mcm7-709for and Mcm7-1348rev (Schmitt et al 2009) for amplification of the Mcm7 region and in some cases we carried out a nested PCR using 1 μl of the PCR product and the internal primers Mcm7-CalicF and Mcm7-CalicR . The protein coding β-tubulin was amplified using the primers Bt3-LM and Bt10-LM (Myllys et al 2001).…”

Section: Molecular Techniquesmentioning

confidence: 99%

Phylogeny, taxonomy and diversification events in the Caliciaceae

Prieto

Wedin

2016

Fungal Diversity

View full text Add to dashboard Cite

Although the high degree of non-monophyly and parallel evolution has long been acknowledged within the mazaediate Caliciaceae (Lecanoromycetes, Ascomycota), a natural re-classification of the group has not yet been accomplished. Here we constructed a multigene phylogeny of the Caliciaceae-Physciaceae clade in order to resolve the detailed relationships within the group, to propose a revised classification, and to perform a dating study. The few characters present in the available fossil and the complex character evolution of the group affects the interpretation of morphological traits and thus influences the assignment of the fossil to specific nodes in the phylogeny, when divergence time analyses are carried out. Alternative fossil assignments resulted in very different time estimates and the comparison with the analysis based on a secondary calibration demonstrates that the most likely placement of the fossil is close to a terminal node rather than a basal placement in the Calicium clade. Our dating analysis show two successive events giving rise to main clades of mazaediate taxa within the Caliciaceae, in the Upper-Lower Cretaceous boundary and in the Paleocene. As a result of this study, Cyphelium is synonymized with Calicium, Acolium is resurrected, and the new genera Allocalicium and Pseudothelomma are described. Twelve new combinations are proposed: Acolium karelicum, Acolium marcianum, Allocalicium adaequatum, Calicium carolinianum, Calicium lecideinum, Calicium lucidum, Calicium notarisii, Calicium pinicola, Calicium trachyliodes, Pseudothelomma occidentale, Pseudothelomma ocellatum and Thelomma brunneum. A key for the mazaedium-producing Caliciaceae is included.

show abstract

“…The protein coding Beta-tubulin gene was amplified using the 9 primers Bt3-LM, B10-LM (Myllys et al, 2001) and the newly designed Collemataceae primers BetaCollF (AGGCATCTGGAAACAAATATGT) and BetaCollR (GCGCCACGGCTTGTCAACG); and the locus MCM7 using the primers MCM7-709 and MCM7 1348 (Schmitt et al, 2009b). PCR amplifications were performed using Illustra TM Hot…”

Section: Dna Sequencingmentioning

confidence: 99%

“…The nrLSU rDNA was amplified using the primers LR7 (Vilgalys and Hester, 1990), nrLSU 0170-R (Otálora et al, 2010) and the newly designed Collemataceae primers LR500CollF (ACCAAGGAGTCTAACGTCCCCG) and LR1200CollR (CATTCGGCCGGTGAGCTGTTACG); mtSSU rDNA using the primers mtSSU1 and mtSSU3R (Zoller et al, 1999). The protein coding Beta-tubulin gene was amplified using the primers Bt3-LM, B10-LM (Myllys et al, 2001) and the newly designed Collemataceae primers BetaCollF (AGGCATCTGGAAACAAATATGT) and BetaCollR (GCGCCACGGCTTGTCAACG); and the locus MCM7 using the primers MCM7-709 and MCM7 1348 (Schmitt et al, 2009b). PCR amplifications were performed using Illustra TM Hot…”

Section: Dna Sequencingmentioning

confidence: 99%

Cardinal characters on a slippery slope – A re-evaluation of phylogeny, character evolution, and evolutionary rates in the jelly lichens (Collemataceae s. str)

Otálora

Aragón

Martínez

et al. 2013

Molecular Phylogenetics and Evolution

View full text Add to dashboard Cite

PostprintThis is the accepted version of a paper published in Molecular Phylogenetics and Evolution. This paper has been peer-reviewed but does not include the final publisher proof-corrections or journal pagination. Citation for the original published paper (version of record):Otálora, M., Aragón, G., Martínez, I., Wedin, M. (2013) Cardinal characters on a slippery slope -A re-evaluation of phylogeny, character evolution, and evolutionary rates in the jelly lichens (Collemataceae s. str.). Evolution, http://dx.doi.org/10. 1016/j.ympev.2013.04.004 Access to the published version may require subscription. Here we reconstruct the phylogeny of Collemataceae using Bayesian and maximum likelihood analyses based on mitochondrial (mtSSU rDNA) and nuclear (nuLSU rDNA, Betatubulin and MCM7) markers of 70 Collemataceae species. We studied the evolution of four morphological and ecological characters traditionally used to delimit genera and infra-generic Molecular Phylogenetics andgroups. Finally, we tested if differences in branch-lengths between clades are due to differences in rates of molecular evolution. Eleven strongly supported groups were recovered in the resulting well-resolved and well-supported phylogeny. The presence/absence of a eucortex, which is currently used as the cardinal character to define genera in the group, does not characterize monophyletic groups corresponding to the genera as currently circumscribed.Ancestral state reconstruction indicates that the most recent common ancestor of the jelly lichens most likely was saxicolous/terricolous, lacked a tomentum, and had transversally septate ascospores. Although the cortex state could not be reconstructed for the ancestor of the family, our observations indicate that a lack of cortex may have an evolutionary advantage in saxicolous/terricolous species in semi-arid environments, as non-corticate species tends to be larger and occur in higher frequency and abundance in such regions, compared to corticate species. A significant evidence for faster evolutionary rates was found in a lineage mainly including taxa that occur in the wet tropics and humid temperate regions, compared to other lineages. We suggest that this can explain the greater diversity of Collemataceae in tropical and humid areas.Key words: Accelerated evolutionary rates, ancestral state reconstruction, Collemataceae, cortex, habitat, lichen-forming fungi. 4 IntroductionLichens are fungi utilizing photosynthetic algae or cyanobacteria for the exploitation of carbohydrates. The symbiotic association allows both the fungal and algal partners to colonize a range of habitats which otherwise would be inhabitable to them. Molecular phylogenetic studies have recently led to significant advances in the understanding of relationships between fungal groups including lichen fungi (Lutzoni et al., 2004; Miadlikowska et al., 2006;Hibbett et al., 2007; Ekman et al., 2008). These and other studies have provided strong evidence that many commonly used morphological and anatomical characters traditionally...

show abstract

[beta]-Tubulin, ITS and Group I Intron Sequences Challenge the Species Pair Concept in Physcia aipolia and P. caesia

Cited by 95 publications

References 0 publications

Phylogenetic analysis indicates transitions from vegetative to sexual reproduction in theLobaria retigeragroup (Lecanoromycetidae, Ascomycota)

Phylogenetic analysis indicates transitions from vegetative to sexual reproduction in theLobaria retigeragroup (Lecanoromycetidae, Ascomycota)

Phylogeny, taxonomy and diversification events in the Caliciaceae

Cardinal characters on a slippery slope – A re-evaluation of phylogeny, character evolution, and evolutionary rates in the jelly lichens (Collemataceae s. str)

Contact Info

Product

Resources

About