Beta-defensin genomic copy number is not a modifier locus for cystic fibrosis

Hollox, Edward J.; Davies, Jane A.; Griesenbach, Uta; Burgess, J.C.; Alton, Eric W.F.W.; Armour, John A.L.

doi:10.1186/1477-5751-4-9

Cited by 30 publications

(27 citation statements)

References 28 publications

(27 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Consistent with previous data (18)(19)(20)(21), copy number among the parents of these 26 families varied between 2 and 7, with a modal copy number of 4 and a mean of 4.58. We observed that at least 24 offspring inherited recombinant haplotypes in which parental copies of the ␤-defensin repeat had been reassorted.…”

Section: Resultssupporting

confidence: 76%

“…S1), such that completely null (zero-copy) haplotypes could be created by simple allelic recombination between such chromosomes. By contrast, in typing Ͼ1,500 unrelated individuals for ␤-defensin copy number (18)(19)(20)24), we have observed only a single example of an individual with 1 copy, suggesting that zero-copy haplotypes are infrequent and may be very rare. However, a zero-copy haplotype is most likely to be found in combination with a 2-copy haplotype and thus will escape unambiguous detection by diploid copy number measurement alone; we do not yet have sufficiently precise data on frequencies of haplotypes with different copy numbers at each site to establish whether the observed frequency of 1-copy individuals represents a significant departure from the predictions of a neutral model.…”

Section: Resultsmentioning

confidence: 61%

“…In some families where additional information was required we also typed the microsatellite EPEV-2 as described (19) and measured copy number using the alternative PRT system PRT107A using primers FAM-PRT107AF (5Ј FAM-AGCCTCATTTAACTTTGGTGC) and PRT107AR (GGCTATGAAGCAATGGCCTA).…”

Section: Methodsmentioning

confidence: 99%

“…For most of these genes there is little detailed information about function and expression (14), and the ␤-defensin CNV forms part of a complex spectrum of population and evolutionary dynamics in this region of the genome (17). Nearly all individuals have between 2 and 7 copies of this cluster per diploid genome (18)(19)(20)(21), but some individuals can have up to 12 copies, with the highest-copy-number haplotypes forming the basis of the cytogenetic 8p23.1 euchromatic variant (18,22). In the more frequent copy number range, low ␤-defensin copy number has been reported to be associated with Crohn's disease of the colon (23) and high copy number with predisposition to psoriasis (20).…”

mentioning

confidence: 99%

See 3 more Smart Citations

Allelic recombination between distinct genomic locations generates copy number diversity in human β-defensins

Bakar

Hollox

Armour

2009

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

␤-Defensins are small secreted antimicrobial and signaling peptides involved in the innate immune response of vertebrates. In humans, a cluster of at least 7 of these genes shows extensive copy number variation, with a diploid copy number commonly ranging between 2 and 7. Using a genetic mapping approach, we show that this cluster is at not 1 but 2 distinct genomic loci Ϸ5 Mb apart on chromosome band 8p23.1, contradicting the most recent genome assembly. We also demonstrate that the predominant mechanism of change in ␤-defensin copy number is simple allelic recombination occurring in the interval between the 2 distinct genomic loci for these genes. In 416 meiotic transmissions, we observe 3 events creating a haplotype copy number not found in the parent, equivalent to a germ-line rate of copy number change of Ϸ0.7% per gamete. This places it among the fastest-changing copy number variants currently known.

show abstract

Section: Resultssupporting

confidence: 76%

Section: Resultsmentioning

confidence: 61%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Allelic recombination between distinct genomic locations generates copy number diversity in human β-defensins

Bakar

Hollox

Armour

2009

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…Most HBD genes are found in a cluster at 8p23.1 , which is polymorphic in copy number (Hollox et al 2005). Individuals have 2-12 copies of this repeat per diploid genome.…”

Section: Defensinsmentioning

confidence: 99%

Antimicrobial peptides and pregnancy

Frew¹,

Stock²

2011

Reproduction

View full text Add to dashboard Cite

Antimicrobial peptides (AMPs) are small proteins produced by epithelial surfaces and inflammatory cells, which have broad-spectrum antimicrobial and immunomodulatory activities. They are known to be important in a number of infectious and inflammatory conditions and have been shown to be present in a number of sites throughout the female reproductive tract. Inflammation and infection are associated with a number of complications of pregnancy including preterm labor, and AMPs may play a key role in maintaining and protecting pregnancy. The aim of this review is to describe the expression and function of AMPs in the pregnant female reproductive tract and their relation to preterm labor.

show abstract

High-resolution mapping of the 8p23.1 beta-defensin cluster reveals strictly concordant copy number variation of all genes

et al. 2008

View full text Add to dashboard Cite

One unexpected feature of the human genome is the high structural variability across individuals. Frequently, large regions of the genome show structural polymorphisms and many vary in their abundance. However, accurate methods for the characterization and typing of such copy number variations (CNV) are needed. The defensin cluster at the human region 8p23.1 is one of the best studied CNV regions due to its potential clinical relevance for innate immunity, inflammation, and cancer. The region can be divided into two subclusters, which harbor predominantly either alpha- or beta-defensin genes. Previous studies assessing individual copy numbers gave different results regarding whether the complete beta-defensin cluster varies or only particular genes therein. We applied multiplex ligation-dependent probe amplification (MLPA) to measure defensin locus copy numbers in 42 samples. The data show strict copy number concordance of all 10 loci typed within the beta-defensin cluster in each individual, while seven loci within the alpha-defensin cluster are consistently found as single copies per chromosome. The exception is DEFA3, which is located within the alpha-defensin cluster and was found to also differ in copy number interindividually. Absolute copy numbers ranged from two to nine for the beta-defensin cluster and zero to four for DEFA3. The CNV-typed individuals, including HapMap samples, are publicly available and may serve as a universal reference for absolute copy number determination. On this basis, MLPA represents a reliable technique for medium- to high-throughput typing of 8p23.1 defensin CNV in association studies for diverse clinical phenotypes.

show abstract

Beta-defensin genomic copy number is not a modifier locus for cystic fibrosis

Cited by 30 publications

References 28 publications

Allelic recombination between distinct genomic locations generates copy number diversity in human β-defensins

Allelic recombination between distinct genomic locations generates copy number diversity in human β-defensins

Antimicrobial peptides and pregnancy

High-resolution mapping of the 8p23.1 beta-defensin cluster reveals strictly concordant copy number variation of all genes

Contact Info

Product

Resources

About