Bestrophin Gene Mutations in Patients with Best Vitelliform Macular Dystrophy

Caldwell, Germaine; Kakuk, Laura E.; Griesinger, Irina B.; Simpson, Stacey A.; Nowak, Norma J.; Small, Kent W.; Maumenee, Irene H.; Rosenfeld, Philip J.; Sieving, Paul A.; Shows, Thomas B.; Ayyagari, Radha

doi:10.1006/geno.1999.5808

Cited by 83 publications

(71 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This was a higher number than expected, as although BEST1 mutations are associated with varied expression of the fundus phenotype, it is considered a rarity that the EOG light rise remains unaffected, with only a few individual cases reported. 3,[13][14][15][19][20][21][22][23][24] The present findings, when combined with published data, demonstrate that of the 269 unique BEST1 mutations thus far collated, at least 3.3% have now been associated with a greater than expected EOG amplitude (Table 1). 25 In collecting these data we are able to highlight two potential reasons whereby erroneous conclusions may be made when interpreting the results of either electrophysiological or genetic testing.…”

Section: Discussionsupporting

confidence: 64%

See 1 more Smart Citation

Normal Electrooculography in Best Disease and Autosomal Recessive Bestrophinopathy

Khan

Islam

Holder

et al. 2018

Retina

View full text Add to dashboard Cite

SUMMARY STATEMENTThe Bestrophinopathies are a group of inherited eye disorders that arise from either dominant or recessive mutations in the BEST1 gene. Electrooculography is invaluable in the diagnosis of Best disease (BD) and autosomal recessive bestrophinopathy (ARB), as a reduced Arden ratio is a highly penetrant feature of disease. We demonstrate that EOG phenotype in BD and ARB is more variable than currently appreciated. Conclusions:The current work provides significant clinical evidence that the EOG phenotype in BD and ARB is more variable than currently appreciated. As a normal EOG may occur in the presence of a classical fundus appearance, the consequences of BEST1 mutation may be independently expressed, possibly mediated via differential effects on intracellular calcium homeostasis.4

show abstract

Section: Discussionsupporting

confidence: 64%

“…This has only been described once before and in our series this genotype always had an abnormal EOG. 19 The ability to generate a light rise therefore may in some cases be strongly influenced by the genotype (p.Arg47Cys, p.Ala234Val) whilst other factors, yet to be determined, are responsible for the remainder.…”

Section: Discussionmentioning

confidence: 99%

Normal Electrooculography in Best Disease and Autosomal Recessive Bestrophinopathy

Khan

Islam

Holder

et al. 2018

Retina

View full text Add to dashboard Cite

show abstract

“…1 In these cases, the unaffected family members carry only one of the heterozygous mutations. While over 100 different BEST1 mutations have been CCATGGCCCCTCTAATTTCT 363 2 GAGGTCCAGAGCAGGGAAGGGT CAGCCCCAGCCACATCCTT 327 3 GAGGCAGTCCCACTCCTACC GCAGCTCCTCGTGATCCTC 278 4 CTCCTGCCCAGGCTTCTACGT CCACCCATCTTCCATTCCT 326 5 GGTTCCTATAGGTCAGCAGGTG GAAACCTTGTTTCCTGTGGAC 303 6 TGGTACCTGGAGAAGAGGTG CCTTGGTCCTTCTAGCCTCA 219 7 CATCCTGATTTCAGGGTTCC GACACTGCATCCTCGTCTCA 298 8 ATGGGGTGTGGAAATAGCAG GAGGGGAAGGGTTGATCATT 290 9 CTCCAAGTCATCAGGCACAT GCAGACCCCTGCACTAGGAG 284 10-1 GGTGTTGGTCCTTTGTCCAC TGACACTGTGAAGCTTTGACG 430 10-2 CTGGAAGCTTAAGGCTGTGG TAGGCTCAGAGCAAGGGAAG 481 11 CTTTGCCCTCCTACTGCAAC TCCTTAAGTGCCGTTGTTCA 487 described in families affected by Best disease, [13][14][15][16][17] only a few combinations of compound heterozygous mutations in arBVMD have been reported. [1][2][3][4][5]11 In our study, the affected children were found to have a combination of two heterozygous mutations: c.122T4C (L41P) and c. 602T4C (I201T).…”

Section: Discussionmentioning

confidence: 99%

A novel compound heterozygous mutation in the BEST1 gene causes autosomal recessive Best vitelliform macular dystrophy

Zhao

Grob

Corey

et al. 2012

Eye

View full text Add to dashboard Cite

Purpose To determine the genetic basis of early onset autosomal recessive Best vitelliform macular dystrophy (arBVMD) in a family with three affected children. Design Clinical and family-based genetic study. Methods Seven subjects making up a family with three children affected by Best vitelliform macular dystrophy were studied. Standard ophthalmic exam with dilated ophthalmoscopy and imaging were performed in each individual. The eleven exons of BEST1 were directly sequenced. Results All three affected children have the clinical characteristic features of Best vitelliform macular dystrophy: large macular vitelliform lesions, scattered vitelliform lesions along the arcades and in the peripheral retina, and an accumulation of serous retinal fluid. A novel compound heterozygous mutation in the BEST1 gene was found in the three affected individuals (L41P and I201T). The unaffected parents and children only harbor one heterozygous mutation. Conclusion arBVMD can be caused by the compound heterozygous mutation L41P and I201T in the BEST1 gene.

show abstract

“…Various possibilities have been discussed in the literature, including the different physiological effects of the lipofuscin material, incomplete penetrance, environment, and pattern of BEST1 expression in the macula. 32,40,44 Wabbels and colleagues describe two separate families with reduced penetrance and late disease onset with BEST1 mutations of Ile295del and Asn99Lys. 2 Within our cohort, there were no such families with a preponderance of asymptomatic individualsFrather most families had a spectrum of disease severityFwith some unaffected mutation carriers balanced by others who were clearly affected ( Table 3).…”

Section: Mutationmentioning

confidence: 99%

“…2,16,25,31 Considerable variation in VMD disease expressivity has been observed. 16,26,[32][33][34][35] The funduscopic appearance of VMD varies depending on disease severity and stage. Traditionally, five main patterns of retinal dystrophy are described: 28 (1) previtelliform (normal macula or only slight RPE disturbance); (2) vitelliform (an 'egg yolk' lesion); (3) pseudohypopyon (sinking of the yellow deposits inferiorly); (4) vitelliruptive ('scrambled egg' appearance with partial resorption of yellow deposits); (5) atrophic.…”

mentioning

confidence: 99%

Best's macular dystrophy in Australia: phenotypic profile and identification of novel BEST1 mutations

Cohn

Turnbull

Ruddle

et al. 2010

Eye

View full text Add to dashboard Cite

Purpose (1) To evaluate the spectrum of BEST1 mutations within Australian Best Disease or vitelliform macular dystrophy (VMD) pedigrees, including any novel mutations; (2) to analyse the range of clinical presentations of this cohort; (3) to determine any possible genotype-phenotype correlations and (4) to compare clinical data of patients with phenotypic VMD, both with and without a BEST1 mutation. Patients and methods Patients with suspected VMD were referred to clinical centres for ophthalmological assessment and genetic screening. When a mutation was identified in a proband, further family members were invited for clinical and genetic screening. Results We identified 42 patients with one of 13 BEST1 mutations. Seven mutations were novel. There were a further 14 probands in whom a BEST1 mutation was not identified. Median visual acuity in both VMD (mutation positive) and clinical VMD (no BEST1 mutation identified) groups reached driving standards (6/12 or better). Conclusion We did not identify any firm genotype-phenotype correlations in our Australian VMD pedigrees, in which there was a spectrum of BEST1 mutations and marked variation in clinical presentation. Genetic screening remains the gold standard for VMD diagnosis. Patients should be counselled that visual acuity might remain at or above driving standards in at least one eye even in the presence of a BEST1 mutation.

show abstract

Bestrophin Gene Mutations in Patients with Best Vitelliform Macular Dystrophy

Cited by 83 publications

References 15 publications

Normal Electrooculography in Best Disease and Autosomal Recessive Bestrophinopathy

Normal Electrooculography in Best Disease and Autosomal Recessive Bestrophinopathy

A novel compound heterozygous mutation in the BEST1 gene causes autosomal recessive Best vitelliform macular dystrophy

Best's macular dystrophy in Australia: phenotypic profile and identification of novel BEST1 mutations

Contact Info

Product

Resources

About