Behaviour of Escherichia coli strains during semi-hard and hard raw milk cheese production

Peng, Silvio; Schafroth, K.; Jakob, E.; Stephan, Roger; Hummerjohann, Jörg

doi:10.1016/j.idairyj.2013.02.012

Cited by 6 publications

(4 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The behavior of the STEC in cheese rinds remained relatively similar to the one in cheese cores with a slow decrease during the storage step (water activity slowly decreased during this step but remained above 0.96 whereas pH increased to reach 6.5 at d 56). For each strain, the level of STEC was generally higher in rinds than in cores, as observed previously (Peng et al, 2013b); higher pH values can explain this observation. Significant differences between cores and rinds were observed during the entire ripening and storage steps (P < 0.05) for the STEC strains belonging to the serotypes O103:H2 and O157:H7, but only at the end of the storage step for the STEC strains belonging to the serotypes O26:H11 and O145:H28.…”

Section: Short Communicationsupporting

confidence: 86%

Short communication: Behavior of different Shiga toxin-producing Escherichia coli serotypes (O26:H11, O103:H2, O145:H28, O157:H7) during the manufacture, ripening, and storage of a white mold cheese

Miszczycha

Bel

Gay-Perret

et al. 2016

Journal of Dairy Science

View full text Add to dashboard Cite

Ruminants are healthy carriers of Shiga toxin-producing Escherichia coli (STEC). If good hygienic and agricultural practices at the farm level, especially during the milking process, are not adequately followed, milk and dairy products made with raw milk could become contaminated. Sporadic cases and rare food outbreaks have been linked with dairy products. Consequently, understanding STEC behavior in cheeses would help to evaluate risks for human health. The behavior of 4 different STEC strains belonging to the serotypes O26:H11, O103:H2, O145:H28, and O157:H7 were monitored during the manufacture, ripening, and storage of a white mold soft cheese. These strains, originating from dairy products, were inoculated individually in raw milk from cow at 10(2) cfu/mL. During the first 24 to 36h of the manufacturing stage, the STEC level increased by 2 to 3 log10 cfu/g. Over the course of the ripening stage, the concentration of the non-O157 STEC remained relatively constant, whereas a decrease of the E. coli O157:H7 concentration was observed. During the storage stage, the level of the different non-O157 STEC strains decreased slowly in the core and in the rind of cheeses. The non-O157 STEC level reached between 3.1 and 4.1 log10 cfu/g at d 56. Interestingly, the concentration of the E. coli O157:H7 strain decreased dramatically: the strains remained detectable only after enrichment. During ripening and storage, STEC levels were generally higher in rinds than in cheese cores. In contrast to what was seen in cheese cores, the E. coli O157:H7 strain remained enumerable in rinds during these steps. These results highlight that STEC can grow during the manufacture and survive during the ripening and storage of a white mold soft cheese.

show abstract

Section: Short Communicationsupporting

confidence: 86%

Short communication: Behavior of different Shiga toxin-producing Escherichia coli serotypes (O26:H11, O103:H2, O145:H28, O157:H7) during the manufacture, ripening, and storage of a white mold cheese

Miszczycha

Bel

Gay-Perret

et al. 2016

Journal of Dairy Science

View full text Add to dashboard Cite

show abstract

“…by Ross et al (2003). Only sporadically, the challenge tests were performed to evaluate behaviour of simple saprophytic E. coli populations during commercial production of semi-hard and hard raw milk cheese (Peng et al, 2013). Our ambition for this study was to investigate the effects of LAB used as a starter culture to limit potential growth of E. coli during milk acidification and thus prevent from its unacceptable increase prior to ripening.…”

Section: Introductionmentioning

confidence: 99%

Modelling and predicting the simultaneous growth of Escherichia coli and lactic acid bacteria in milk

Ačai

Valı́k

Medveďová

et al. 2016

Food sci. technol. int.

View full text Add to dashboard Cite

Modelling and predicting the simultaneous competitive growth of Escherichia coli and starter culture of lactic acid bacteria (Fresco 1010, Chr. Hansen, Hørsholm, Denmark) was studied in milk at different temperatures and Fresco inoculum concentrations. The lactic acid bacteria (LAB) were able to induce an early stationary state in E. coli The developed model described and tested the growth inhibition of E. coli (with initial inoculum concentration 10(3) CFU/mL) when LAB have reached maximum density in different conditions of temperature (ranging from 12 ℃ to 30 ℃) and for various inoculum sizes of LAB (ranging from approximately 10(3) to 10(7) CFU/mL). The prediction ability of the microbial competition model (the Baranyi and Roberts model coupled with the Gimenez and Dalgaard model) was first performed only with parameters estimated from individual growth of E. coli and the LAB and then with the introduced competition coefficients evaluated from co-culture growth of E. coli and LAB in milk. Both the results and their statistical indices showed that the model with incorporated average values of competition coefficients improved the prediction of E. coli behaviour in co-culture with LAB.

show abstract

“…Primers, sequences, and parameters for amplification of virulence and antibiotic resistance genes in E. coli isolates by using polymerase chain reaction (PCR). ATAAAATTCTTGAAGACGAAA GACAGTTACCAATGCTTAATCA [42], [47] blaSHV blaSHV SHV-F SHV-R 19 19 50 885…”

Section: 5mentioning

confidence: 99%

Evaluation of bacteriophage to reduce Escherichia coli contamination in different food samples

Allam

Shafik²,

Elshibiny³

2022

Alfarama Journal of Basic & Applied Sciences

View full text Add to dashboard Cite

Food security is critical in the foodstuffs industry since most bacterial pathogens may cause foodborne illnesses and harm general health. In food, E. coli infection was recognized as the major cause of many cases of foodborne diseases. Moreover, the hazards have increased remarkably as most bacteria have acquired resistance to many antibiotics. Bacteriophages (phages) are a natural alternative agent that can be used for food preservation; they are viruses that can target bacteria specifically without causing harm to the human, plant, or animal cells. This research aimed to evaluate the efficacy of phage isolates in suppressing E. coli strains isolated from food samples. The phage was collected from sewage water and tested against E. coli isolate (EC/20) in vitro. Phage ZCECO 5 genome size was assessed to be ~339.5 kbp, and electron microscopy examination revealed that it related to the Myohoviridae family. In addition, it was found to be tolerant to a wide range of temperatures and pH. At different Multiplicity of Infections (MOIs), it showed a decrease in bacterial counts, with more bacterial elimination at stronger MOIs. Additionally, at MOI 10, the phage inhibited E. coli optical density from 1.0 OD 600 to 0.7 OD 600 after 230 min, and following a four-hour incubation period at 37 °C, the bacterial titer decreased. The results indicated that ZCECO 5 could lyse E. coli and inhibit its activity. As a result, phage ZCECO 5 is suggested to be a bio-control agent in food for E. coli control.

show abstract

Behaviour of Escherichia coli strains during semi-hard and hard raw milk cheese production

Cited by 6 publications

References 12 publications

Short communication: Behavior of different Shiga toxin-producing Escherichia coli serotypes (O26:H11, O103:H2, O145:H28, O157:H7) during the manufacture, ripening, and storage of a white mold cheese

Short communication: Behavior of different Shiga toxin-producing Escherichia coli serotypes (O26:H11, O103:H2, O145:H28, O157:H7) during the manufacture, ripening, and storage of a white mold cheese

Modelling and predicting the simultaneous growth of Escherichia coli and lactic acid bacteria in milk

Evaluation of bacteriophage to reduce Escherichia coli contamination in different food samples

Contact Info

Product

Resources

About