Bacterial associates of Hyalesthes obsoletus (Hemiptera: Cixiidae), the insect vector of bois noir disease, with a focus on cultivable bacteria

Introduction of a putative biocontrol agent into a range of phytoplasma‐ and liberibacter‐susceptible crop plants

“…Our detection of DLB in plant tissues following a fairly aggressive leaf‐washing procedure suggests that DLB was present, not merely on the leaf surface, but that it penetrated and established itself inside the plant tissue. Furthermore, the fact that DLB could be detected in the foliage of some plants following soil drenching supports previous observations that it also penetrated the root system and systemically moved throughout the plant.…”

“…DLB stocks were kept at −80 °C in a 30% glycerol stock and were freshly streaked on a modified CCT‐agar, composed of sucrose (67 g L −1 ), sorbitol (10 g L −1 ), Lysogeny broth (LB, Difco) (2 g L −1 ) and Bacto‐agar (13 g L −1 ), and cultivated at 28 °C. Liquid DLB cultures were prepared by inoculating a 3–5 mL starter containing Nutrient Broth (NB, Difco) or LB media with a single DLB colony from agar plates.…”

“…The presence of DLB was determined by PCR with species‐specific DLB primers (DLBF, 5′‐CTCTGTGGGTGGCGAGTGGC‐3′ and DLBR, 5′‐ACCGTCAGTTCCGCCGGG‐3′), as described elsewhere . PCR products of environmental samples (i.e.…”

“…We recently isolated a Gram‐negative, Dyella ‐like bacterium (DLB) from Hyalesthes obsoletus (Hemiptera: Cixiidae), the vector of Bois Noir phytoplasma in grapevines . This indicates that H. obsoletus can carry both DLB and Bois Noir phytoplasma; however, it is not known whether the two bacteria simultaneously co‐inhabit H. obsoletus .…”

“…Microscopic and polymerase chain reaction (PCR) analyses of DLB‐inoculated grapevines indicated that DLB cells were located inside the phloem tissue and could persist for up to a month following application . Importantly, DLB inhibited the growth of the Mollicute Spiroplasma melliferum in vitro , and markedly reduced phytoplasma‐induced symptoms in grapevine plantlets . Furthermore, the complete genome of DLB was recently sequenced and deposited in the GenBank (NCBI) under accession no.…”