B-cell-stimulatory factor 2 (beta 2 interferon) functions as a second signal for interleukin 2 production by mature murine T cells.

Abstract

Purified peripheral murine T cells, in the presence of concanavalin A, can be activated to produce interleukin 2 (IL-2) through stimulation either with a previously described murine lymphokine designated T cell-activating factor (TAF) or with a cloned human lymphokine that has been called P2 interferon, B-cell-stimulatory factor 2, hybridoma growth factor, inducible 26-kDa protein, or hematopoietic colony-stimulating factor 309 by different investigators. We and others propose the designation interleukin 6 (IL-6) for the latter molecule. Our experiments demonstrate that either murine TAF or human IL-6 can restore the ability of purified T cells to proliferate in response to Con A or antibodies against the T-cell antigen receptor. Most if not all of the proliferation can be blocked by antibodies against the a chain of the IL-2 receptor. Furthermore, highly purified CD8-T cells can be activated by IL-6 in the presence of Con A to secrete IL-2. We propose that IL-6 and murine TAF are important "second signals" in primary antigen-receptor-dependent T-cell activation. Whether or not murine TAF is a homologue of human IL-6 remains to be determined.The antigen-dependent pathway of T-cell proliferation appears to require engagement of the T-cell receptor complex by antigen associated with one of the major histocompatibility complex (MHC)-encoded glycoproteins (1)

Interleukin 7 is a T-cell growth factor.

“…Interleukin 2 (IL-2) was originally considered to be the sole T-cell growth factor (1). However, IL-4, which was originally characterized as a B-cell growth factor (2), has been found to induce T-cell proliferation in an IL-2-independent manner (3), and IL-6, which was initially recognized as a B-cell differentiation and hybridoma growth factor (4), subsequently was also found to function as a T-cell growth factor in either an IL-2-dependent (5) or an IL-2-independent (6) manner.…”

Infiltration of Canonical Vγ4/Vδ1 γδ T Cells in an Adriamycin-Induced Progressive Renal Failure Model

“…The nomenclature used is according to Garman et al (9). The V␥ primers are as follows: V␥1.1, ctacaatcactccccttagac; V␥1.2, cgagtatttctccacacagct; V␥2, gggtcgacgaagaaccc tggctcacaagc; V␥3, tcctggatatctcaggatcag; V␥4, acgtcacctctggggtcatat; V␥5, ggtcctctgctataatgactt; C␥2a, gcaaaggtatgtcccagtct; C␥ probe, ggcttgggrgaaat gtc; and C␥ sequencing primer, gggcttgggggaaatgtctg.…”

Inflammatory microcrystals stimulate interleukin‐6 production and secretion by human monocytes and synoviocytes

“…In contrast, IL-6 is the major hepatocyte-stimulating factor (HSF), and it also displays many other functions, including pyrogenicity and the stimulation of hematopoietic colony formation, in which it synergizes with IL-3 (11). In addition, it modulates the growth and differentiation of B lymphocytes (12,13), T lymphocytes (14)(15)(16), and chondrocytes (Guerne P-A, Lotz M: unpublished observations). We have demonstrated previously that this cytokine is present in the synovial fluid (SF) of patients with diverse arthropathies (17).…”