Axl Deficiency Does Not Affect Adipogenesis or Adipose Tissue Development

Abstract

To evaluate a potential role of Axl, the high‐affinity receptor of growth arrest‐specific protein 6 (GAS6) in adiposity, murine embryonic fibroblasts (MEF) derived from mice with genetic deficiency of Axl (Axl−/−) or wild‐type littermates (Axl+/+) were differentiated into mature adipocytes. In addition, Axl−/− and Axl+/+ mice were kept on standard fat diet (SFD) or on high‐fat diet (HFD) for 15 weeks. Deficiency of Axl in MEF did not affect differentiation, as shown by a similar uptake of Oil Red O and expression of the adipogenic markers aP2 and peroxisome proliferator activator receptor γ (PPARγ) at the end of the differentiation. In the first 7 weeks of HFD feeding, Axl−/− mice gained less weight than their wild‐type littermates. Weight gain for both genotypes on either SFD of HFD over 15 weeks was, however, not significantly different, resulting in comparable body weights, as well as subcutaneous (s.c.) and gonadal (GON) fat mass. Adipocyte size in the fat tissues was not affected by Axl deficiency. Gene expression analysis indicated that the absence of Axl in vivo may be compensated for by the other TAM family members Mer and Tyro3. Glucose and insulin tolerance tests (ITT) in Axl−/− and Axl+/+ mice did not reveal significant differences in glucose homeostasis. Thus, Axl deficiency had no significant effect on adipogenesis in vitro or in vivo.

Effect ofGAS6andAXLGene Polymorphisms on Adiposity, Systemic Inflammation, and Insulin Resistance in Adolescents

“…Our findings indicated that AXL gene polymorphisms might not play a significant role in childhood obesity. Recently, Scroyen and colleagues [37] have published similar findings indicating that deficiency in a single Axl receptor did not significantly affect adipogenesis or adipose tissue development in mice. This is because an Axl deficiency can be partially compensated by other TAM family members (Tyro-3 and Mer) via Gas6 interaction.…”

Regulation of Energy Metabolism by Receptor Tyrosine Kinase Ligands

“…As the mouse phenotypes were not due to behavioral changes in food intake or in activity levels, it led to the hypothesis that GAS6-Axl activation may directly impair glucose and lipid metabolism in peripheral organs. However, the global Axl-KO mice did not show any difference in body weight gain or subcutaneous and gonadal fat mass under either standard or high-fat diet (Scroyen et al, 2012). This could be due to compensatory effects by the other two TAM receptors that were upregulated in the Axl-KO mice (Scroyen et al, 2012).…”

Effect of vascular endothelial growth factor receptor 2 antagonism on adiposity in obese mice

“…To monitor insulin signaling, analysis of Akt and Phospho (P) Akt in extracts of SC or GON adipose tissues was performed using the primary antibodies Akt or P-Akt (9272 or 9271, Cell Signaling Technology, Danvers, MA, USA), as described (Scroyen et al 2012). Data are normalized to b-actin as internal control and expressed as the ratio P-Akt/Akt.…”

“…TaqMan gene expression assays (Life Technologies) were used to analyze the mRNA levels in SC and GON adipose tissues of adiponectin (Mm 00456425_m1) and Glut4 (Slc2a4; Mm 00436615_m1), with b-actin (Mm 01205647_g1) as housekeeping gene, as described elsewhere (Scroyen et al 2012). For peroxisome proliferator-activated receptor g (PPARg), the following primer and probe set was used: fw, ctgtcggttcagaagtgcct; rev, atctccgccaacagcttctc; probe: cccaaacctgatggcattg tgagaca.…”