Autosomal Dominant Frontotemporal Lobar Degeneration in a Filipino Family with Progranulin Mutation

Dominguez, Jacqueline C.; Ng, Arlene R.; Yu, Jeryl T.; Guevarra, Anne Cristine Deocariza; Daroy, Maria Luisa G; Alfon, Alicia; Catindig, Joseree Ann; Dizon, Mercedes; Santiago, Joel Ferreira; Moral, Maria Clarissa Del; Yu, Justine Megan F.; Jamerlan, Angelo; Ligsay, Antonio D.; Bagyinszky, Eva; An, Seong Soo A.; Kim, SangYun

doi:10.1159/000510106

Cited by 5 publications

(5 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We observed atrophy and hypometabolism in the left frontal, temporal, and parietal lobes in our patient, which is consistent with the asymmetric atrophy reported in GRN mutation carriers [25][26][27]. The white matter hyperintense signal in our patient has also been previously reported [20,28]. Amyloid and tau PET were negative, although one case of FTD with GRN mutation in the literature had TAR DNA-binding protein 43 (TDP-43) protein inclusions [29].…”

Section: U N C O R R E C T E D a U T H O R P R O O Fsupporting

confidence: 91%

“…GRN mutations are rare in China [7], with a prevalence of just 1.2%-2.6% [15][16][17][18][19], and have been infrequently reported in other Asian countries including Japan, Philippines, India, and Korea (where they have never been observed) [20][21][22][23][24]. In contrast, GRN mutations are common in Western countries, accounting for 34.6% of mutations in patients with FTD in Western countries [25].…”

Section: U N C O R R E C T E D a U T H O R P R O O Fmentioning

confidence: 99%

See 1 more Smart Citation

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

Chu

Nan

Jiang

et al. 2023

JAD

View full text Add to dashboard Cite

Background: Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. Objective: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. Methods: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. Results: Neuroimaging revealed marked lateral atrophy and hypometabolism in the patient’s left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.141414_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient’s genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients—mostly female—with GRN mutations; the prevalence was 1.2% –2.6% and patients mostly had early disease onset. Conclusion: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD.

show abstract

Section: U N C O R R E C T E D a U T H O R P R O O Fsupporting

confidence: 91%

Section: U N C O R R E C T E D a U T H O R P R O O Fmentioning

confidence: 99%

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

Chu

Nan

Jiang

et al. 2023

JAD

View full text Add to dashboard Cite

show abstract

“…Most studies demonstrated the concordance between structural MRI and FDG-PET in MAPT (43,45), GRN (84,85), and C9orf72 (74, 77) mutation carriers. However, controversy still existed regarding the earlier or more sensitive biomarkers (43,45,77).…”

Section: Orf _fdg-petmentioning

confidence: 95%

Molecular imaging biomarkers in familial frontotemporal lobar degeneration: Progress and prospects

et al. 2022

View full text Add to dashboard Cite

Familial frontotemporal lobar degeneration (FTLD) is a pathologically heterogeneous group of neurodegenerative diseases with diverse genotypes and clinical phenotypes. Three major mutations were reported in patients with familial FTLD, namely, progranulin (GRN), microtubule-associated protein tau (MAPT), and the chromosome 9 open reading frame 72 (C9orf72) repeat expansion, which could cause neurodegenerative pathological changes years before symptom onset. Noninvasive quantitative molecular imaging with PET or single-photon emission CT (SPECT) allows for selective visualization of the molecular targets in vivo to investigate brain metabolism, perfusion, neuroinflammation, and pathophysiological changes. There was increasing evidence that several molecular imaging biomarkers tend to serve as biomarkers to reveal the early brain abnormalities in familial FTLD. Tau-PET with 18F-flortaucipir and 11C-PBB3 demonstrated the elevated tau position in patients with FTLD and also showed the ability to differentiate patterns among the different subtypes of the mutations in familial FTLD. Furthermore, dopamine transporter imaging with the 11C-DOPA and 11C-CFT in PET and the 123I-FP-CIT in SPECT revealed the loss of dopaminergic neurons in the asymptomatic and symptomatic patients of familial FTLD. In addition, PET imaging with the 11C-MP4A has demonstrated reduced acetylcholinesterase (AChE) activity in patients with FTLD, while PET with the 11C-DAA1106 and 11C-PK11195 revealed an increased level of microglial activation associated with neuroinflammation even before the onset of symptoms in familial FTLD. 18F-fluorodeoxyglucose (FDG)-PET indicated hypometabolism in FTLD with different mutations preceded the atrophy on MRI. Identifying molecular imaging biomarkers for familial FTLD is important for the in-vivo assessment of underlying pathophysiological changes with disease progression and future disease-modifying therapy. We review the recent progress of molecular imaging in familial FTLD with focused on the possible implication of these techniques and their prospects in specific mutation types.

show abstract

“…Heterozygous loss-of-function (LOF) mutations in granulin ( GRN ) gene leading to progranulin (PGRN) happloinsufficiency have been identified as a major cause of familial frontotemporal lobar degeneration with TDP-43 accumulation (FTLD-TDP) [ 1 , 2 , 3 , 4 , 5 , 6 ]. FTLD-TDP patients exhibit behavioral changes and language difficulties associated with the neuronal death in the frontal and temporal lobar brain cortex.…”

Section: Introductionmentioning

confidence: 99%

Progranulin Deficiency Induces Mitochondrial Dysfunction in Frontotemporal Lobar Degeneration with TDP-43 Inclusions

et al. 2023

View full text Add to dashboard Cite

Loss-of-function (LOF) mutations in GRN gene, which encodes progranulin (PGRN), cause frontotemporal lobar degeneration with TDP-43 inclusions (FTLD-TDP). FTLD-TDP is one of the most common forms of early onset dementia, but its pathogenesis is not fully understood. Mitochondrial dysfunction has been associated with several neurodegenerative diseases such as Alzheimer’s disease (AD), Parkinson’s disease (PD) and amyotrophic lateral sclerosis (ALS). Here, we have investigated whether mitochondrial alterations could also contribute to the pathogenesis of PGRN deficiency-associated FTLD-TDP. Our results showed that PGRN deficiency induced mitochondrial depolarization, increased ROS production and lowered ATP levels in GRN KD SH-SY5Y neuroblastoma cells. Interestingly, lymphoblasts from FTLD-TDP patients carrying a LOF mutation in the GRN gene (c.709-1G>A) also demonstrated mitochondrial depolarization and lower ATP levels. Such mitochondrial damage increased mitochondrial fission to remove dysfunctional mitochondria by mitophagy. Interestingly, PGRN-deficient cells showed elevated mitochondrial mass together with autophagy dysfunction, implying that PGRN deficiency induced the accumulation of damaged mitochondria by blocking its degradation in the lysosomes. Importantly, the treatment with two brain-penetrant CK-1δ inhibitors (IGS-2.7 and IGS-3.27), known for preventing the phosphorylation and cytosolic accumulation of TDP-43, rescued mitochondrial function in PGRN-deficient cells. Taken together, these results suggest that mitochondrial function is impaired in FTLD-TDP associated with LOF GRN mutations and that the TDP-43 pathology linked to PGRN deficiency might be a key mechanism contributing to such mitochondrial dysfunction. Furthermore, our results point to the use of drugs targeting TDP-43 pathology as a promising therapeutic strategy for restoring mitochondrial function in FTLD-TDP and other TDP-43-related diseases.

show abstract

Autosomal Dominant Frontotemporal Lobar Degeneration in a Filipino Family with Progranulin Mutation

Cited by 5 publications

References 39 publications

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

Molecular imaging biomarkers in familial frontotemporal lobar degeneration: Progress and prospects

Progranulin Deficiency Induces Mitochondrial Dysfunction in Frontotemporal Lobar Degeneration with TDP-43 Inclusions

Contact Info

Product

Resources

About