Autoplaquing in Neisseria gonorrhoeae

Campbell, Lara A.; Short, Helen B.; Young, Frank E.; Clark, Virginia L.

doi:10.1128/jb.164.1.461-465.1985

Cited by 13 publications

(6 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1). Included in the tested strains were some strains previously reported to be highly autolytic (strain RD5) (Hebeler and Young, 1975), resistant to autolysis (strains CS-7 and CV-1) (Cacciapuoti et al, 1979) or prone to autoplaquing (strains RUN5287 and RUN5290) a phenomenon thought to be related to autolysis (Campbell et al, 1985). Although AtlA does not greatly affect the major autolytic activity that occurs during early stationary phase, it was possible that these strains would have differences in autolysis that could be related to atlA.…”

Section: Resultsmentioning

confidence: 99%

A variable genetic island specific for Neisseria gonorrhoeae is involved in providing DNA for natural transformation and is found more often in disseminated infection isolates

Dillard¹,

Seifert

2001

Molecular Microbiology

175

292

View full text Add to dashboard Cite

Neisseria gonorrhoeae (the gonococcus) is the causative agent of the sexually transmitted disease gonorrhoea. Most gonococcal infections remain localized to the genital tract but, in a small proportion of untreated cases, the bacterium becomes systemic to produce the serious complication of disseminated gonococcal infection (DGI). We have identified a large region of chromosomal DNA in N. gonorrhoeae that is not found in a subset of gonococcal isolates (a genetic island), in the closely related pathogen, Neisseria meningitidis or in commensal Neisseria that do not usually cause disease. Certain versions of the island carry a serum resistance locus and a gene for the production of a cytotoxin; these versions of the island are found preferentially in DGI isolates. All versions of the genetic island encode homologues of F factor conjugation proteins, suggesting that, like some other pathogenicity islands, this region encodes a conjugation‐like secretion system. Consistent with this hypothesis, a wild‐type strain released large amounts of DNA into the medium during exponential growth without cell lysis, whereas an isogenic strain mutated in a peptidoglycan hydrolase gene (atlA) was drastically reduced in its ability to donate DNA for transformation during growth. This genetic island constitutes the first major discriminating factor between the gonococcus and the other Neisseria and carries genes for providing DNA for genetic transformation.

show abstract

Section: Resultsmentioning

confidence: 99%

A variable genetic island specific for Neisseria gonorrhoeae is involved in providing DNA for natural transformation and is found more often in disseminated infection isolates

Dillard¹,

Seifert

2001

Molecular Microbiology

175

292

View full text Add to dashboard Cite

show abstract

“…Chromosomal DNA of each strain was amplified using primers 77F (5′‐TAACAGCAGACGCTCC ATTC‐3′) and 86R (5′‐CAAGCGCATGGTACATGAAT‐3′) (Tm 57°C; extension time 90 s) and using primers 73F (5′‐AGCC ATCAGGGAGGCGGATA‐3′) and hlh‐ggiR (5′‐CAGGCAAAC AGCTATTTGAG‐3′) (Tm 54°C; extension time 90 s). The dif site and the imperfect dif site were sequenced from the following strains: PID2076, JC1, IN644, IN113831, LT38089, LT38093, DGI14, DGI20, LT37971, PID2004 (Dillard and Seifert, 2001), RUN5290, RUN5287 (Campbell et al ., 1985).…”

Section: Methodsmentioning

confidence: 99%

Neisseria gonorrhoeae secretes chromosomal DNA via a novel type IV secretion system

Hamilton

Domínguez

Schwartz

et al. 2005

Molecular Microbiology

263

428

View full text Add to dashboard Cite

SummaryThe process of DNA donation for natural transformation of bacteria is poorly understood and has been assumed to involve bacterial cell death. Recently in Neisseria gonorrhoeae we found that mutations in three genes in the gonococcal genetic island (GGI) reduced the ability of a strain to act as a donor in transformation and to release DNA into the culture. To better characterize the GGI and the process of DNA donation, the 57 kb genetic island was cloned, sequenced and subjected to insertional mutagenesis. DNA sequencing revealed that the GGI has characteristics of a horizontally acquired genomic island and encodes homologues of type IV secretion system proteins. The GGI was found to be incorporated near the chromosomal replication terminus at the dif site, a sequence targeted by the site-specific recombinase XerCD. Using a plasmid carrying a small region of the GGI and the associated dif site, we demonstrated that this model island could be integrated at the dif site in strains not carrying the GGI and was spontaneously excised from that site. Also, we were able to delete the entire 57 kb region by transformation with DNA from a strain lacking the GGI. Thus the GGI was likely acquired and integrated into the gonococcal chromosome by site-specific recombination and may be lost by site-specific recombination or natural transformation. We made mutations in six putative type IV secretion system genes and assayed these strains for the ability to secrete DNA. Five of the mutations greatly reduced or completely eliminated DNA secretion. Our data indicate that N. gonorrhoeae secretes DNA via a specific process. Donated DNA may be used in natural transformation, contributing to antigenic variation and the spread of antibiotic resistance, and it may modulate the host immune response.

show abstract

“…In a study that detected a novel phage targeting N. subflava , single plaques derived from dental plaque swabs were used to re-infect the same host-culture; only the first and second round of propagation resulted in plaques [ 21 ]. The exact mechanism of losing infectivity or developing host resistance is unclear but is a common observation [ 22 ].…”

Section: Discussionmentioning

confidence: 99%

“…Previously reported autoplaquing in N. gonorrhoeae [ 22 ] could be explained by autolysis or the presence of two different functionally active prophages [ 25 , 38 ]. However, we did not observe any lysis zones during the negative control experiments in which we used bacterial culture lysates in GBC+.…”

Section: Discussionmentioning

confidence: 99%

“…To the best of our knowledge, no phages active against N. gonorrhoeae have ever been found. In 1985, Campbell et al observed plaques on lawns of two different strains of N. gonorrhoeae , but no phage particles active against this pathogenic species were finally isolated and identified [ 22 ]. Bioinformatic analyses of N. gonorrhoeae strain FA1090 have revealed the presence of four integrated filamentous phage genomes (Ngoϕ6–9) [ 23 ].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Screening of Anorectal and Oropharyngeal Samples Fails to Detect Bacteriophages Infecting Neisseria gonorrhoeae

et al. 2022

View full text Add to dashboard Cite

There are real concerns that Neisseria gonorrhoeae may become untreatable in the near future due to the rapid emergence of antimicrobial resistance. Alternative therapies are thus urgently required. Bacteriophages active against N. gonorrhoeae could play an important role as an antibiotic-sparing therapy. To the best of our knowledge, no bacteriophages active against N. gonorrhoeae have ever been found. The aim of this study was to screen for bacteriophages able to lyse N. gonorrhoeae in oropharyngeal and anorectal swabs of 74 men who have sex with men attending a sexual health clinic in Antwerp, Belgium. We screened 210 swabs but were unable to identify an anti-gonococcal bacteriophage. This is the first report of a pilot screening that systematically searched for anti-gonococcal phages directly from clinical swabs. Further studies may consider screening for phages at other anatomical sites (e.g., stool samples, urine) or in environmental settings (e.g., toilet sewage water of sex clubs or sexually transmitted infection clinics) where N. gonorrhoeae can be found.

show abstract

Autoplaquing in Neisseria gonorrhoeae

Cited by 13 publications

References 21 publications

A variable genetic island specific for Neisseria gonorrhoeae is involved in providing DNA for natural transformation and is found more often in disseminated infection isolates

A variable genetic island specific for Neisseria gonorrhoeae is involved in providing DNA for natural transformation and is found more often in disseminated infection isolates

Neisseria gonorrhoeae secretes chromosomal DNA via a novel type IV secretion system

Screening of Anorectal and Oropharyngeal Samples Fails to Detect Bacteriophages Infecting Neisseria gonorrhoeae

Contact Info

Product

Resources

About