Automated design of synthetic ribosome binding sites to control protein expression

Abstract

Microbial engineering often requires fine control over protein expression; for example, to connect genetic circuits 1-7 or control flux through a metabolic pathway 8-13. We have developed a predictive design method for synthetic ribosome binding sites that enables the rational control of a protein's production rate on a proportional scale. Experimental validation of over 100 predictions in Escherichia coli shows that the method is accurate to within a factor of 2.3 over a range of 100,000-fold. The design method also correctly predicts that reusing a ribosome binding site sequence in different genetic contexts can result in different protein expression levels. We demonstrate the method's utility by rationally optimizing a protein's expression level to connect a genetic sensor to a synthetic circuit. The proposed forward engineering approach will accelerate the construction and systematic optimization of large genetic systems.

Using cellular fitness to map the structure and function of a major facilitator superfamily effluxer

“…Here, tet(B) is expressed by the arabinose‐inducible, glucose‐repressible promoter, pBAD, where we use a saturating arabinose concentration to obtain a largely homogeneous cellular population expressing tet(B) (Khlebnikov et al , 2000). We ensured moderate translational expression of TetB by engineering a ribosome binding site (RBS) sequence that provided measurable resistance at minimal fitness cost (Materials and Methods; Salis et al , 2009). The final construct was integrated into the E. coli BW25113 chromosome using a site‐specific method for insertion at the Tn7 attachment sites downstream of the highly conserved glutamine synthetase gene, glmS (McKenzie & Craig, 2006).…”

“…A ribosome binding site (RBS) sequence (GAGAGACTCCTCTCCATAACGAGGCCTATAAAC) was inserted upstream of tet(B) . The RBS sequence was designed with the Salis Lab RBS calculator and had an arbitrary strength of 20,000 (Salis et al , 2009). Stronger RBS sequences that induced much greater levels of TetB were found to also increase fitness costs, and therefore, we decided upon a more moderate strength for the RBS sequence.…”

The Synthetic Biology Open Language (SBOL) provides a community standard for communicating designs in synthetic biology

“…In Eugene, these researchers imported the publicly available RBS and terminator sequences 24,25 from the iGEM Registry through the Clotho platform 26 , and specified nonpublicly available terminator sequences manually. By using Eugene rules, the researchers pruned the number of possible toggle switch cassette variations that are fully annotated with DNA sequences.…”

Design-based re-engineering of biosynthetic gene clusters: plug-and-play in practice

“…RBSs can be engineered with the help of programs like the RBS Calculator [32] or RBSDesigner [33], which aid in constructing synthetic RBSs with a desired translation initiation rate for a given coding sequence.…”

“…The strength of RBSs and promoters is context-dependent: different gene or protein expression rates are usually obtained with different upstream or downstream DNA sequences [32,34 ]. Recently, Lou et al [34 ] could show that the rates of transcription can be decoupled from the contextual effect of the junction with the downstream part, by using ribozyme-based insulators between the promoter and the RBS to create uniform 5 0 -UTR ends of mRNA [34 ].…”