Autocrine Signaling Underlies Fast Repetitive Plasma Membrane Translocation of Conventional and Novel Protein Kinase C Isoforms in β Cells

Wuttke, Anne; Yu, Qian; Tengholm, Anders

doi:10.1074/jbc.m115.698456

Cited by 15 publications

(15 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Additionally our approach revealed that ATP triggers the activity of PKC kinase. This observation is in agreement with the current hypothesis proposing that ATP promotes insulin exocytosis partly by raising calcium concentration and partly by increasing DAG via PLC pathway4445. These results illustrate how unbiased MS-based phosphoproteomics can be applied to identify molecular targets involved in known outcomes as well as those involved in as yet uncharacterized effect of the drugs.…”

Section: Discussionsupporting

confidence: 91%

Glucose-regulated and drug-perturbed phosphoproteome reveals molecular mechanisms controlling insulin secretion

et al. 2016

View full text Add to dashboard Cite

Insulin-secreting beta cells play an essential role in maintaining physiological blood glucose levels, and their dysfunction leads to the development of diabetes. To elucidate the signalling events regulating insulin secretion, we applied a recently developed phosphoproteomics workflow. We quantified the time-resolved phosphoproteome of murine pancreatic cells following their exposure to glucose and in combination with small molecule compounds that promote insulin secretion. The quantitative phosphoproteome of 30,000 sites clustered into three main groups in concordance with the modulation of the three key kinases: PKA, PKC and CK2A. A high-resolution time course revealed key novel regulatory sites, revealing the importance of methyltransferase DNMT3A phosphorylation in the glucose response. Remarkably a significant proportion of these novel regulatory sites is significantly downregulated in diabetic islets. Control of insulin secretion is embedded in an unexpectedly broad and complex range of cellular functions, which are perturbed by drugs in multiple ways.

show abstract

Section: Discussionsupporting

confidence: 91%

Glucose-regulated and drug-perturbed phosphoproteome reveals molecular mechanisms controlling insulin secretion

et al. 2016

View full text Add to dashboard Cite

show abstract

“…It is possible that this manipulation activates a completely different set of downstream DAG effector proteins. It has, for example, recently been shown that different PKC isoforms can decode Ca 2+ and DAG changes differently in β cells (25), so the magnitude, synchronization, and duration of these second messenger signals will control downstream signaling events.…”

Section: Discussionmentioning

confidence: 99%

“…Two mutations in the SMP domain of GFP‐opto—E‐Syt1 were generated by site‐directed mutagenesis using the following primers: for L308W, 5′‐GCTGCCTTCCTCGTGTTGCCCAACCGATGGCTGGTGCCCC‐3′ and rev 5′‐CGACGGAAGGAGCACAACGGGTTGGCTACCGACCACGGGG‐3′; for V169W, 5′‐GCTTCTGGCTGAAACTGTGGCTCCGGCTTGGAGGGGATCTA‐3′ and rev 5′‐CGAAGACCGACTTTGACACCGAGGCCGAACCTCCCCTAGAT‐3′ (12) (Q5 Site‐Directed Mutagenesis Kit; New England Biolabs, Ipswich, MA, USA). Infra‐red fluorescent protein (iRFP)‐tandem C2‐domains of PKC (C1aC1b) C1aC1b was generated by replacing GFP with iRFP (24) in the previously described GFP‐C1aC1b (25). All salts, cyclopiazonic acid, carbamoylcholine, and diazoxide were from MilliporeSigma (Burlington, MA, USA).…”

Section: Methodsmentioning

confidence: 99%

Feedback regulation of insulin secretion by extended synaptotagmin‐1

2018

View full text Add to dashboard Cite

Endoplasmic reticulum (ER)—plasma membrane (PM) contacts are dynamic structures with important roles in the regulation of calcium (Ca2+) and lipid homeostasis. The extended synaptotagmins (E‐Syts) are ER‐localized lipid transport proteins that interact with PM phosphatidylinositol 4,5‐bisphosphate in a Ca2+‐dependent manner. E‐Syts bidirectionally transfer glycerolipids, including diacylglycerol (DAG), between the 2 juxtaposed membranes, but the biologic significance of this transport is still unclear. Using insulin‐secreting cells and live‐cell imaging, we now show that Ca2+‐triggered exocytosis of insulin granules is followed, in sequence, by PM DAG formation and E‐Syt1 recruitment. E‐Syt1 counteracted the depolarization‐induced DAG formation through a mechanism that required both voltage‐dependent Ca2+ influx and Ca2+ release from the ER. E‐Syt1 knockdown resulted in prolonged accumulation of DAG in the PM, resulting in increased glucose‐stimulated insulin secretion. We conclude that Ca2+‐triggered exocytosis is temporally coupled to Ca2+‐triggered E‐Syt1 PM recruitment and removal of DAG to negatively regulate the same process.—Xie, B., Nguyen, P. M., Idevall‐Hagren, O. Feedback regulation of insulin secretion by extended synaptotagmin‐1. FASEB J. 33, 4716–4728 (2019). http://www.fasebj.org

show abstract

“…This hypothesis suggests that some IP3 is generated locally, whereas the biosensor assay we use in this study can detect only changes in global PIP2. Imaging techniques such as total internal reflection fluorescence (Wuttke et al, 2016) and a knockdown of potentially relevant signaling components can test these ideas in the future.…”

Section: Discussionmentioning

confidence: 99%

Teaching an Old Drug New Tricks: Agonism, Antagonism, and Biased Signaling of Pilocarpine through M3 Muscarinic Acetylcholine Receptor

2017

View full text Add to dashboard Cite

Pilocarpine is a prototypical drug used to treat glaucoma and dry mouth and is classified as either a full or partial muscarinic agonist. Here, we report several unexpected results pertaining to its interaction with muscarinic M3 receptor (M3R). We found that pilocarpine was 1000 times less potent in stimulating mouse-eye pupil constriction than muscarinic agonists oxotremorin-M (Oxo-M) or carbachol (CCh), although all three ligands have similar values for M3R. In contrast to CCh or Oxo-M, pilocarpine does not induce Ca mobilization via endogenous M3R in human embryonic kidney cell line 293T (HEK293T) or mouse insulinoma (MIN6) cells. Pilocarpine also fails to stimulate insulin secretion and, instead, antagonizes the insulinotropic effect of Oxo-M and CCh-induced Ca upregulation; however, in HEK293T or Chinese hamster ovary-K1 cells overexpressing M3R, pilocarpine induces Ca transients like those recorded with another cognate G protein-coupled muscarinic receptor, M1R. Stimulation of cells overexpressing M1R or M3R with CCh resulted in a similar reduction in phosphatidylinositol 4,5-bisphosphate (PIP2). In contrast to CCh, pilocarpine stimulated PIP2 hydrolysis only in cells overexpressing M1R but not M3R. Moreover, pilocarpine blocked CCh-stimulated PIP2 hydrolysis in M3R-overexpressing cells, thus, it acted as an antagonist. Pilocarpine activates extracellular regulated kinase 1/2 in MIN6 cells. The stimulatory effect on extracellular regulated kinase (ERK1/2) was blocked by the Src family kinase inhibitor PP2, indicating that the action of pilocarpine on endogenous M3R is biased toward -arrestin. Taken together, our findings show that pilocarpine can act as either an agonist or antagonist of M3R, depending on the cell type, expression level, and signaling pathway downstream of this receptor.

show abstract

Autocrine Signaling Underlies Fast Repetitive Plasma Membrane Translocation of Conventional and Novel Protein Kinase C Isoforms in β Cells

Cited by 15 publications

References 51 publications

Glucose-regulated and drug-perturbed phosphoproteome reveals molecular mechanisms controlling insulin secretion

Glucose-regulated and drug-perturbed phosphoproteome reveals molecular mechanisms controlling insulin secretion

Feedback regulation of insulin secretion by extended synaptotagmin‐1

Teaching an Old Drug New Tricks: Agonism, Antagonism, and Biased Signaling of Pilocarpine through M3 Muscarinic Acetylcholine Receptor

Contact Info

Product

Resources

About