Authentic
            <i>In Vitro</i>
            Replication of Two Tombusviruses in Isolated Mitochondrial and Endoplasmic Reticulum Membranes

Xu, Kai; Huang, Tyng-Shyan; Nagy, Peter D.

doi:10.1128/jvi.00973-12

Cited by 41 publications

(46 citation statements)

References 85 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To test the nature of the viral RNAs produced during TBSV replication, we utilized a yeast cell-free extract (CFE) that is capable of supporting a single full cycle of authentic TBSV replication, starting with the in vitro assembly of the membranebound TBSV replicase and followed by the production of (Ϫ) RNA and abundant (ϩ)RNA progeny in a membrane-dependent manner (26,27,30). As the final product of replication, the newly synthesized (ϩ)RNAs are released from the VRC to the buffer, while the (Ϫ)RNA stays in the nuclease-resistant membranebound VRCs (26,27).…”

Section: Resultsmentioning

confidence: 99%

Template Role of Double-Stranded RNA in Tombusvirus Replication

Kovalev

Pogany

Nagy

2014

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

Section: Resultsmentioning

confidence: 99%

Template Role of Double-Stranded RNA in Tombusvirus Replication

Kovalev

Pogany

Nagy

2014

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

“…Yeast strains BY4741 (MATa his3⌬1 leu2⌬0 met15⌬0 ura3⌬0) and sti1⌬ (single-gene deletion strain) were obtained from Open Biosystems (Huntsville, AL, USA). For tombusviral replication in yeast, pESC-HisCNVp33-DI72, pYES-CNVp92, pESC-C36/DI72, and pYES-C95 were described previously (57). To generate pESC-C36/DI1, CIRV DI-1 (93) (constructed by D. Barajas andTo generate Twin-Strep-tagged CIRV and CNV replication proteins, the primer pairs 5351 (CATCCACAATTCGAAAAATCTGCTGGTGGA GGTGGATCCATGGATACCATCAAGAGGATG)/952 (CCCGCTCGA GTCATGCTACGGCGGAGTCAAGGA), 5350 (GTGGTTCTGGTGGT GGTTCTGGTGGTTCTGCTTGGTCTCATCCACAATTCGAAAAATC TG)/952, and 5349 (GGAAGATCTAAAAATGTCTGCTTGGTCTCA TCCACAATTCGAAAAAGGTGGTGGTTCTGGTGGTGGTTCTGGT GG)/952 were sequentially used for PCR using template pYES-CNVp92 to introduce the Twin-Strep tag on CNV p92, generating a Twin-Streptagged CNV p92 sequence.…”

Section: Methodsmentioning

confidence: 99%

“…The two viral replication proteins (i.e., p33 and p92 pol for TBSV and p36 and p95 pol in the case of CIRV) is known to coopt 8 to 10 host proteins to assemble the tombusvirus VRC (37)(38)(39)(50)(51)(52). The highly homologous p33 of TBSV and p36 of CIRV replication proteins are master regulators of replication, playing a multifunctional role in recruitment of the tombusviral (ϩ)RNA to the site of replication, the assembly of the VRC, and viral RNA synthesis by acting as RNA chaperones (50,(53)(54)(55)(56)(57). The RdRp protein p92 pol of TBSV and p95 pol of CIRV are also components of the functional VRCs (28,55,(57)(58)(59).…”

mentioning

confidence: 99%

“…The highly homologous p33 of TBSV and p36 of CIRV replication proteins are master regulators of replication, playing a multifunctional role in recruitment of the tombusviral (ϩ)RNA to the site of replication, the assembly of the VRC, and viral RNA synthesis by acting as RNA chaperones (50,(53)(54)(55)(56)(57). The RdRp protein p92 pol of TBSV and p95 pol of CIRV are also components of the functional VRCs (28,55,(57)(58)(59). The subverted host proteins have been shown to bind to the viral RNA and the viral replication proteins (8,39,60).…”

mentioning

confidence: 99%

See 1 more Smart Citation

The Hop-Like Stress-Induced Protein 1 Cochaperone Is a Novel Cell-Intrinsic Restriction Factor for Mitochondrial Tombusvirus Replication

Lin

Nagy

2014

J Virol

Self Cite

View full text Add to dashboard Cite

“…4D, lanes 3 to 4), confirming that the WW domain interferes with the functions of p33 replication protein. Similar to wt p33 (34,75) and the YFP-p33, the WW-YFP-p33 is associated with membranes (was inserted into the lipid bilayer) in yeast based on fractionation and washing with 1 M NaCl, which could remove peripheral membrane proteins (Fig. 4E).…”

Section: Inhibition Of the Rna-binding And Protein-interaction Functimentioning

confidence: 99%

Novel Mechanism of Regulation of Tomato Bushy Stunt Virus Replication by Cellular WW-Domain Proteins

Barajas

Kovalev

Qin

et al. 2015

J Virol

Self Cite

View full text Add to dashboard Cite

Replication of (؉)RNA viruses depends on several co-opted host proteins but is also under the control of cell-intrinsic restriction factors (CIRFs). By using tombusviruses, small model viruses of plants, we dissect the mechanism of inhibition of viral replication by cellular WW-domain-containing proteins, which act as CIRFs. By using fusion proteins between the WW domain and the p33 replication protein, we show that the WW domain inhibits the ability of p33 to bind to the viral RNA and to other p33 and p92 replication proteins leading to inhibition of viral replication in yeast and in a cell extract. Overexpression of WWdomain protein in yeast also leads to reduction of several co-opted host factors in the viral replicase complex (VRC). These host proteins, such as eEF1A, Cdc34 E2 ubiquitin-conjugating enzyme, and ESCRT proteins (Bro1p and Vps4p), are known to be involved in VRC assembly. Simultaneous coexpression of proviral cellular factors with WW-domain protein partly neutralizes the inhibitory effect of the WW-domain protein. We propose that cellular WW-domain proteins act as CIRFs and also as regulators of tombusvirus replication by inhibiting the assembly of new membrane-bound VRCs at the late stage of infection. We suggest that tombusviruses could sense the status of the infected cells via the availability of cellular susceptibility factors versus WWdomain proteins for binding to p33 replication protein that ultimately controls the formation of new VRCs. This regulatory mechanism might explain how tombusviruses could adjust the efficiency of RNA replication to the limiting resources of the host cells during infections. IMPORTANCEReplication of positive-stranded RNA viruses, which are major pathogens of plants, animals, and humans, is inhibited by several cell-intrinsic restriction factors (CIRFs) in infected cells. We define here the inhibitory roles of the cellular Rsp5 ubiquitin ligase and its WW domain in plant-infecting tombusvirus replication in yeast cells and in vitro using purified components. The WW domain of Rsp5 binds to the viral RNA-binding sites of p33 and p92 replication proteins and blocks the ability of these viral proteins to use the viral RNA for replication. The WW domain also interferes with the interaction (oligomerization) of p33 and p92 that is needed for the assembly of the viral replicase. Moreover, WW domain also inhibits the subversion of several cellular proteins into the viral replicase, which otherwise play proviral roles in replication. Altogether, Rsp5 is a CIRF against a tombusvirus, and it possibly has a regulatory function during viral replication in infected cells. P lus-stranded (ϩ)RNA viruses, which are widespread and emerging pathogens, replicate in the cytosol of infected cells by assembling membrane-bound viral replicase complexes (VRCs). The VRCs consist of the viral RNA and viral proteins, as well as co-opted host-coded proteins (1-8). Rapid progress has recently been made in understanding the functions of the viral replication proteins, including the v...

show abstract

Authentic In Vitro Replication of Two Tombusviruses in Isolated Mitochondrial and Endoplasmic Reticulum Membranes

Cited by 41 publications

References 85 publications

Template Role of Double-Stranded RNA in Tombusvirus Replication

Template Role of Double-Stranded RNA in Tombusvirus Replication

The Hop-Like Stress-Induced Protein 1 Cochaperone Is a Novel Cell-Intrinsic Restriction Factor for Mitochondrial Tombusvirus Replication

Novel Mechanism of Regulation of Tomato Bushy Stunt Virus Replication by Cellular WW-Domain Proteins

Contact Info

Product

Resources

About