Atypical Chemokine Receptor 3 Generates Guidance Cues for CXCL12-Mediated Endothelial Cell Migration

Abstract

Chemokine receptor CXCR4, its ligand stromal cell-derived factor-1 (CXCL12) and the decoy receptor atypical chemokine receptor 3 (ACKR3, also named CXCR7), are involved in the guidance of migrating cells in different anatomical districts. Here, we investigated the role of the ACKR3 zebrafish ortholog ackr3b in the vascularization process during embryonic development. Bioinformatics and functional analyses confirmed that ackr3b is a CXCL12-binding ortholog of human ACKR3 . ackr3b is transcribed in the endoderm of zebrafish embryos during epiboly and is expressed in a wide range of tissues during somitogenesis, including central nervous system and somites. Between 18 somite and 26 h-post fertilization stages, the broad somitic expression of ackr3b becomes restricted to the basal part of the somites. After ackr3b knockdown, intersomitic vessels (ISVs) lose the correct direction of migration and are characterized by the presence of aberrant sprouts and ectopic filopodia protrusions, showing downregulation of the tip/stalk cell marker hlx1 . In addition, ackr3b morphants show significant alterations of lateral dorsal aortae formation. In keeping with a role for ackr3b in endothelial cell guidance, CXCL12 gradient generated by ACKR3 expression in CHO cell transfectants guides human endothelial cell migration in an in vitro cell co-culture chemotaxis assay. Our results demonstrate that ackr3b plays a non-redundant role in the guidance of sprouting endothelial cells during vascular development in zebrafish. Moreover, ACKR3 scavenging activity generates guidance cues for the directional migration of CXCR4-expressing human endothelial cells in response to CXCL12.

Involvement of Cxcl12a/Cxcr4b Chemokine System in Mediating the Stimulatory Effect of Embryonic Ethanol Exposure on Neuronal Density in Zebrafish Hypothalamus

“…Collectively, these results suggest that EtOH’s effects on ERK signaling in the brain, strongly dependent on dose, is a critical mechanism underlying the influence of EtOH on chemokine signaling and neuronal differentiation in the developing brain. Future studies are needed to elucidate such downstream signaling pathways of the Cxcl12/Cxcr4 axis that are essential in mediating these effects of low‐dose EtOH and also to determine the possible involvement of another Cxcl12 receptor, Cxcr7, which functions in maintaining a concentration gradient of Cxcl12 to provide directional cues for migrating cells (Bussmann and Raz, 2015; Tobia et al, 2019).…”

Role of epigenetic m6A RNA methylation in vascular development:mettl3regulates vascular development through PHLPP2/mTOR‐AKT signaling

“…In vertebrates, the development of the vascular system is composed of two major processes: vasculogenesis and angiogenesis 19 . Although vasculogenesis refers to the differentiation and migration of endothelial cells (ECs) to form a primordial vascular network, angiogenesis refers to the development of new blood vessels from an existing one 20 . In this study, we developed KO zebrafish for mettl3 and showed that mettl3 is required for vascular development.…”

“…org) and synthesized following the cold spring harbor protocol. 22 A small portion [10][11][12][13][14][15][16][17][18][19][20] of embryos injected with gRNA and ribonucleoprotein complexes (Cas9 RNPs from Mirus Bio LLC, Wisconsin, USA) were characterized at 24 hpf through the isolation of DNA, PCR analysis around the target site using specific primers (F: GCCTTGGCGACTGCTCCTTTCTAA, R: TCCCACCCCTTTTCGTAACGCTGTA), and DNA sequencing analysis to determine whether potential mutations were introduced. After the presence of potential mutations was confirmed with the finding of multiple mixed sequence peaks after the PAM sequence, the injected embryos were raised to adulthood (Figure S1D-F).…”

“…19 Although vasculogenesis refers to the differentiation and migration of endothelial cells (ECs) to form a primordial vascular network, angiogenesis refers to the development of new blood vessels from an existing one. 20 In this study, we developed KO zebrafish for mettl3 and showed that mettl3 is required for vascular development. The finding was confirmed by the knockdown (KD) of mettl3 using morpholino (MO) in zebrafish.…”

CXCR7 Antagonism Reduces Acute Lung Injury Pathogenesis

“…The scavenging activity of CXCR7 expressed on endothelial cells has been proposed to generate CXCL11 and CXCL12 chemokine gradients, thus, enabling a directional migration of CXCR3 + and CXCR4 + cells, respectively, from the circulation toward sites of inflammation (Berahovich et al, 2014;Tobia et al, 2019;Pouzol et al, 2021). To evaluate this hypothesis, the impact of CXCR7 antagonism on plasma and lung tissue CXCL11 and CXCL12 levels and BAL immune cell infiltrates was investigated in the ALI/ARDS DBA/1 mouse model following treatment with ACT-1004-1239.…”