ATR Regulates Fragile Site Stability

Casper, Anne M.; Nghiem, Paul; Arlt, Martin F.; Glover, Thomas W.

doi:10.1016/s0092-8674(02)01113-3

Cited by 523 publications

(491 citation statements)

References 53 publications

Supporting

Mentioning

450

Contrasting

Unclassified

Order By: Relevance

“…No difference was found in the expression level of these sites between AT and AT complemented cells ( Figure 3c). These results are in agreement with a previous study which found no difference in the frequency of gaps and constrictions at fragile sites between AT and normal lymphoblast cell lines (Casper et al, 2002).…”

Section: Resultssupporting

confidence: 94%

“…ATR Interplay between ATM and ATR in fragile site regulation E Ozeri-Galai et al downregulation (ATM þ /ATR À ) resulted in fragile site expression in agreement with previous results (Casper et al, 2002). A significant increase in the number of gaps and constrictions was observed in cells lacking both ATM and ATR compared to cells deficient in ATR alone (Po0.05).…”

Section: Resultssupporting

confidence: 89%

“…siRNA-2 sequence was described previously (Casper et al, 2002). Nonspecific control oligo (Dharmacon, Lafayette, CO, USA) contains 52% GC content similar to the GC content in the specific oligo.…”

Section: Rna Interferencementioning

confidence: 99%

“…ATR plays a central role in the checkpoint response to agents that block replication fork progression (Abraham, 2001). Downregulation of ATR results in increased instability at fragile site following replication stress, and even under normal growth conditions (Casper et al, 2002). Subsequently it has been shown that other proteins involved in cell cycle checkpoints and DNA repair, such as BRCA1, SMC1 and FANCD2, play a role in maintaining fragile site stability (reviewed by Arlt et al, 2006).…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Interplay between ATM and ATR in the regulation of common fragile site stability

et al. 2007

View full text Add to dashboard Cite

Common fragile sites are specific genomic loci that form constrictions and gaps on metaphase chromosomes under conditions that slow, but do not arrest, DNA replication. These sites have been shown to have a role in various chromosomal rearrangements in tumors. Different DNA damage response proteins were shown to regulate fragile site stability, including ataxia-telangiectasia and Rad3-related (ATR) and its effector Chk1. Here, we investigated the role of ataxia-telangiectasia mutated (ATM), the main transducer of DNA double-strand break (DSB) signal, in this regulation. We demonstrate that replication stress conditions, which induce fragile site expression, lead to DNA fragmentation and recruitment of phosphorylated ATM to nuclear foci at DSBs. We further show that ATM plays a role in maintaining fragile site stability, which is revealed only in the absence of ATR. However, the activation of ATM under these replication stress conditions is ATR independent. Following conditions that induce fragile site expression both ATR and ATM phosphorylate Chk1, suggesting that both proteins regulate fragile site expression probably via their effect on Chk1 activation. Our findings provide new insights into the interplay between ATR and ATM pathways in response to partial replication inhibition and in the regulation of fragile site stability.

show abstract

Section: Resultssupporting

confidence: 94%

Section: Resultssupporting

confidence: 89%

Section: Rna Interferencementioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Interplay between ATM and ATR in the regulation of common fragile site stability

et al. 2007

View full text Add to dashboard Cite

show abstract

“…Cells were plated in 6-well plates overnight and then transfected with luciferase (5 0 -CGUACGCGGAAUACU UCGATT-3 0 ), ATM (GCGCCUGAUUCGAGAUCCUUU), hSMG-1 (CCAGGACACGAGGAAACUGTT) or ATR (GCCAAGACAAAUUCUGUGUTT) siRNA (Casper et al, 2002;Yoshida et al, 2003;Brumbaugh et al, 2004). All siRNA transfections were carried out using 100 nM of a given siRNA oligonucleotide unless specified.…”

Section: Rnai Treatmentmentioning

confidence: 99%

hSMG-1 and ATM sequentially and independently regulate the G1 checkpoint during oxidative stress

et al. 2008

View full text Add to dashboard Cite

Genotoxic stress activates the phosphatidylinositol 3-kinase-like kinases (PIKKs) that phosphorylate proteins involved in cell cycle arrest, DNA repair and apoptosis. Previous work showed that the PIKK ataxia telangiectasia mutated (ATM) but not ATM and Rad3 related phosphorylates p53 (Ser15) during hyperoxia, a model of prolonged oxidative stress and DNA damage. Here, we show hSMG-1 is responsible for the rapid and early phosphorylation of p53 (Ser15) and that ATM helps maintain phosphorylation after 24 h. Despite reduced p53 phosphorylation and abundance in cells depleted of hSMG-1 or ATM, levels of the p53 target p21 were still elevated and the G 1 checkpoint remained intact. Conditional overexpression of p21 in p53-deficient cells revealed that hyperoxia also stimulates wortmannin-sensitive degradation of p21. siRNA depletion of hSMG-1 or ATM restored p21 stability and the G 1 checkpoint during hyperoxia. These findings establish hSMG-1 as a proximal regulator of DNA damage signaling and reveal that the G 1 checkpoint is tightly regulated during prolonged oxidative stress by both PIKK-dependent synthesis and proteolysis of p21.

show abstract

Evolution of Common Fragile Sites

Helmrich

2008

Encyclopedia of Life Sciences

View full text Add to dashboard Cite

Common fragile sites are specific deoxyribonucleic acid (DNA) breakage‐prone genomic regions in all healthy humans. Their instability is provoked by replication stress combined with an escape of cell cycle checkpoints. Common fragile sites are favoured regions of chromosomal aberration formation in the neoplastic process. They are inherent parts of the genomes of all so far analysed mammalian species, and recent data support their existence also in yeast. The common fragile site locations are highly conserved between human and other primates as well as between human and mouse. There is no evidence of an involvement of common fragile sites as ‘hotspots’ in chromosome evolution.

show abstract

ATR Regulates Fragile Site Stability

Cited by 523 publications

References 53 publications

Interplay between ATM and ATR in the regulation of common fragile site stability

Interplay between ATM and ATR in the regulation of common fragile site stability

hSMG-1 and ATM sequentially and independently regulate the G1 checkpoint during oxidative stress

Evolution of Common Fragile Sites

Contact Info

Product

Resources

About