ATP-dependent Activation of the Intermediate Conductance, Ca2+-activated K+ Channel, hIK1, Is Conferred by a C-terminal Domain

Abstract

We previously demonstrated that hIK1 is activated directly by ATP in excised, inside-out patches in a protein kinase A inhibitor 5-24 dependent manner, suggesting a role for phosphorylation in the regulation of this Ca 2؉ -dependent channel. However, mutation of the single consensus cAMP-dependent protein kinase phosphorylation site (S334A) failed to modify the response of hIK1 to ATP (Gerlach, A. C., Gangopadhyay, N. N., and Devor, D. C. (2000) J. Biol. Chem. 275, 585-598). Here we demonstrate that ATP does not similarly activate the highly homologous Ca 2؉ -dependent K ؉ channels, hSK1, rSK2, and rSK3. To define the region of hIK1 responsible for the ATP-dependent regulation, we generated a series of hIK1 truncations and hIK1/rSK2 chimeras. ATP did not activate a chimera containing the N terminus plus S1-S4 from hIK1. In contrast, ATP activated a chimera containing the hIK1 C-terminal amino acids His 299 -Lys 427 . Furthermore, truncation of hIK1 at Leu 414 resulted in an ATP-dependent channel, whereas larger truncations of hIK1 failed to express. Additional hIK1/ rSK2 chimeras defined the minimal region of hIK1 required to confer complete ATP sensitivity as including amino acids Arg 355 -Ala 413 . An alanine scan of all nonconserved serines and threonines within this region failed to alter the response of hIK1 to ATP, suggesting that hIK1 itself is not directly phosphorylated. Additionally, substitution of amino acids Arg 355 -Met 368 of hIK1 into the corresponding region of rSK2 resulted in an ATP-dependent activation, which was ϳ50% of that of hIK1. These results demonstrate that amino acids Arg 355 -Ala 413 within the C terminus of hIK1 confer sensitivity to ATP. Finally, we demonstrate that the ATPdependent phosphorylation of hIK1 or an associated protein is independent of Ca 2؉ .The human intermediate conductance K Ca channel, hIK1, is required for a variety of physiological processes including transepithelial ion transport (2-5), vasodilation (6, 7), T cell activation (8, 9), cell proliferation (9 -11), and regulatory volume decrease (9, 10). In addition to demonstrating modulation by intracellular Ca 2ϩ , we and others have demonstrated that hIK1 activity can be dynamically regulated by phosphorylation (1,9,(12)(13)(14). Several of these studies have demonstrated an ATP-dependent activation of hIK1 in excised, inside-out membrane patches that can be reversed by exogenous phosphatases and/or kinase inhibitors (1,12,13). Based on these observations, we speculated that the phosphorylation-dependent modulation of hIK1 plays a critical role in modulating the physiological processes in which hIK1 is involved.In our previous study we demonstrated, in excised, insideout patches, that addition of ATP (1 mM) resulted in, on average, a 3-fold increase in hIK1 activity (1), having an EC 50 of 50 M.1 The stimulatory effect of ATP exhibited a slow onset, requiring several minutes for the maximal response, was strictly Mg 2ϩ -dependent, and could be mimicked by neither hydrolyzeable (ADP, GTP, UTP, CTP, ITP) nor non-...

Role of the NH2 Terminus in the Assembly and Trafficking of the Intermediate Conductance Ca2+-activated K+ Channel hIK1

“…For instance, hIK1 is directly gated by intracellular Ca 2ϩ interacting with calmodulin that is constitutively associated with the COOH terminus of the channel (9 -11). In addition, we have demonstrated that ATP activates hIK1 via cAMP-dependent protein kinase and that this activation relies upon a COOH-terminal domain overlapping the Ca 2ϩ -dependent, calmodulin-binding domain (12,13). We have also demonstrated that hIK1 is inhibited by arachidonic acid (4), recently mapping the inhibitory arachidonic acid binding site to the pore of hIK1 (14).…”

Recycling of the Ca2+-activated K+ Channel, KCa2.3, Is Dependent upon RME-1, Rab35/EPI64C, and an N-terminal Domain

“…In the case of KCa2.3, the following primers were utilized: forward (gatcggtggcggtctgaacgacatcttcgaggctcagaaaatcgaatggcacgaagg) and reverse (gatcccttcgtgccattcgattttctgagcctcgaagatgtcgttcagaccgccacc), where the boldface indicates nucleotides corresponding to the BLAP sequence, the underlined nucleotides indicate those corresponding to the BglII overhang, the nucleotides in italics represent glycines added to provide flexibility at the front and back of the insert, and the nucleotides in normal type were added to maintain the correct reading frame (note that this will result in the addition of a glycine at the 3Ј end of the BLAP sequence). Chimeras between KCa2.3 and KCa3.1 were generated by overlap extension PCR as described previously (19). The 26KCa3.1-KCa2.3 chimera was tagged with a C-terminal myc epitope (EQKLI-SEEDL) using a single step PCR.…”

“…Although a great deal has been learned about the second messenger-dependent regulation of these KCa channels in terms of altering P o (15)(16)(17)(18)(19)(20)(21), much less information exists regarding the mechanisms by which N is determined. We (20,(22)(23)(24) and others (25)(26)(27) have identified numerous motifs in the N and C termini of KCa2.3 and KCa3.1, which are required for the proper assembly and anterograde trafficking of these channels to the plasma membrane.…”

Trafficking of the Ca2+-activated K+Channel, hIK1, Is Dependent upon a C-terminal Leucine Zipper

“…We demonstrated recently (19) that the IK, but not the SK, channel was activated by ATP-dependent phosphorylation and that this was independent of consensus kinase phosphorylation sites on hIK1. We further mapped the domain for this kinase-dependent regulation to a 14-amino acid region (Arg 355 -Met 368 ) overlapping the Ca 2ϩ -dependent calmodulin-binding domain, suggesting this may be the site of additional protein-protein interactions (20). Similarly, PKC has been shown to acutely regulate IK1, and this is independent of consensus PKC phosphorylation sites (21).…”

“…We demonstrated previously that truncation of the 427-amino acid hIK1 at Lys 402 resulted in the complete loss of channel function, as assessed by patch clamp techniques (20). This loss of function could result from either a failure of hIK1 to traffic to the plasma membrane or the expression of non-functional channels.…”