AtCCX3 Is an Arabidopsis Endomembrane H+-Dependent K+ Transporter  

Abstract

The Arabidopsis (Arabidopsis thaliana) cation calcium exchangers (CCXs) were recently identified as a subfamily of cation transporters; however, no plant CCXs have been functionally characterized. Here, we show that Arabidopsis AtCCX3 (At3g14070) and AtCCX4 (At1g54115) 86 Rb + increased in tonoplast-enriched membranes isolated from Arabidopsis lines expressing CCX3 driven by the cauliflower mosaic virus 35S promoter. Overexpression of AtCCX3 in tobacco (Nicotiana tabacum) produced lesions in the leaves, stunted growth, and resulted in the accumulation of higher levels of numerous cations. In summary, these findings suggest that AtCCX3 is an endomembrane-localized H + -dependent K + transporter with apparent Na + and Mn 2+ transport properties distinct from those of previously characterized plant transporters.

AtCCX1 transports Na+ and K+ in Pitch pastoris

“…These results suggest that AtCCX1 be an H + dependent Na + /K + exchanger. Actually, the results are consistent with AtCCX3 and AtCCX4 (Morris et al, 2008). Vacuolar sequestration of Na + not only lowers Na + concentration in the cytoplasm, but also contributes to osmotic adjustment to maintain water uptake from saline solutions.…”

“…However, recently, CCXs in Arabidopsis were also found to be related to Na + compartmentation. Heterologous expression of AtCCX3 in yeast increased accumulation of Na + in yeast (Morris et al, 2008), similar to NHX1 to promote Na + uptake (Kinclova et al, 2003;Darley et al, 2000;Fukuda et al, 2011). When compared with NHX1, AtCCX3 simultaneously transported K + and Mn 2+ apart from Na + .…”

“…The primers CGTTGCTTGAGACACTAGGGTT CTT and ACCTCTACAAATGTGGTATGGCTGAT were used to test the correct reading order of EGFP by PCR. Yeast vacuolar protein P51 was used as a marker protein and fused to EGFP as described previously (Morris et al, 2008;Carter et al, 2004).…”

Characterization of two genes encoding metal tolerance proteins from Beta vulgaris subspecies maritima that confers manganese tolerance in yeast

“…extrusion have been identified. The second mechanism is storing excess metal into vacuole by vacuolar localized transporters such as AtCCX3, ShMTP8 and AtCAX2 (Delhaize et al 2003;Hirschi et al 2000;Morris et al 2008) previously shown to have a role in Mn 2? detoxification.…”

Vacuolar Cation/H+ Antiporters of Saccharomyces cerevisiae*

“…Furthermore, co-expression of AtCAX1 and AtCAX3 in yeast cells leads to the formation of "hetero-CAX" complexes able to transport Li ϩ without affecting Ca 2ϩ transport rate (24). Finally, expression of AtCCX3 (formerly AtCAX9) in yeast cells induced a high capacity uptake of radioactive Rb ϩ in the vacuolar membrane-enriched fraction, which could be inhibited by an excess of cold K ϩ , Na ϩ , and Mn 2ϩ but not Ca 2ϩ (25). AtCAX9 as well as four other CAX transporters from Arabidopsis (AtCAX7-11) have been reassigned to the cation calcium exchanger family together with a mammalian K ϩ -dependent Na ϩ /Ca 2ϩ antiporter (NCKX6) (26,27), based on sequence homology and the presence of a characteristic ␣-repeat.…”