Associations of the Interleukin‐1 Gene Locus Polymorphisms with Risk to Hip and Knee Osteoarthritis: Gender and Subpopulation Differences

Abstract

Genetic predisposition to the complex hereditary disease like osteoarthritis (OA) of the large joints (hip and knee) includes the interleukin-1 gene (IL-1) cluster on chromosome 2. Using a case-control study with 500 OA patients (240 knee and 260 hip OA patients, all with joint replacement), we analysed frequencies of IL-1 gene cluster polymorphisms in Croatian Caucasian population. The control samples came from 531 healthy individuals including blood donors. We genotyped two single nucleotide polymorphisms in the IL-1 gene locus at IL-1A (À889, C>T, rs1800587) and IL-1B (+3594, C>T, rs1143634) and compared their frequencies between patients and controls. We predicted haplotypes by combining current data with our previous results on gene polymorphisms (IL-1B, rs16944 and the IL-1 receptor antagonist gene [IL-1RN] variable number tandem repeat [VNTR]) for the same population. Haplotype analyses revealed gender disparities and showed that women carriers of the 1-2-1-1 haplotype [IL-1A(rs1800587) -IL-1B(rs1143634) -IL-1B(rs16944) -IL-1RN(VNTR)] had sixfold lower risk to develop knee OA. However, carriers of the 1-1-1-2 haplotype of both sexes had over twofold higher predisposition to hip OA. Our results differ from some earlier studies in Caucasian subpopulations, which may be due to the fact that this is the first study to separate genders in assessing the IL-1-locus genetic risk of OA. The results suggest that inflammatory mediators like IL-1 might be implicated in the pathogenesis of primary OA in large joints and that as yet unidentified gender-specific factors exist in a Croatian Caucasian population.

Interleukin‐17 and Toll‐like Receptor 10 genetic polymorphisms and susceptibility to large joint osteoarthritis

“…In our control group, we included individuals younger than 45 years of age because we would have decreased the power of the study, had we included only individuals over 45 years of age (and we would not gain much higher specificity of allele identification). Decrease in power of the study for achieving minimal increase in specificity of allele identification was also the reason to include all individuals (under and over 45 years of age) in control group in our previous studies . Radiological analysis (x‐rays) of knees and hips in the control group has not been done because of ethical and financial limitations.…”

Alternative Interleukin 17A/F Locus Haplotypes Are Associated With Increased Risk to Hip and Knee Osteoarthritis

“…Our goal is to map the risk factors and understand their role in the OA pathogenesis. We have started by studying inflammatory cytokines that seem to be associated with susceptibility to development of OA, which could therefore be important for understanding primary OA pathophysiology. Following the same aim, the IL17 gene locus, whose products could increase predisposition to primary OA, is located on chromosome 6 (6p12.3‐q13), in the area found previously to harbor such genetic risk in the UK population .…”

Susceptibility to large‐joint osteoarthritis (hip and knee) is associated with BAG6 rs3117582 SNP and the VNTR polymorphism in the second exon of the FAM46A gene on chromosome 6

“…The criteria applied for participation in the study were described previously . Basically, these include clinically and radiologically confirmed diagnosis of OA along with affirmative informed consent (to donate blood for research purposes after surgery).…”

“…Genomic DNA from OA patients and healthy control individuals was extracted from whole blood as described previously . A 647‐bp fragment of DNA containing the FAM46A gene was amplified by polymerase chain reaction (PCR) from human genomic DNA using Fam‐labelled forward primer designated Gfam_VF (5'‐AGGGTACTTCGCCATGTCTG‐3') in combination with reverse primer designated GEX_R (5'‐CTCGTGATGGCCACAGATT‐3').…”