Associations of CTLA4 +49 A/G Dimorphism and HLA-DRB1*/DQB1* Alleles With Type 1 Diabetes from South India

Abstract

The aim of present study was to elucidate the association of CTLA4 +49 A/G and HLA-DRB1*/DQB1* gene polymorphism in south Indian T1DM patients. The patients and controls (n = 196 each) were enrolled for CTLA4 and HLA-DRB1*/DQB1* genotyping by RFLP/PCR-SSP methods. The increased frequencies of CTLA4 'AG' (OR = 1.99; p = 0.001), 'GG' (OR = 3.94; p = 0.001) genotypes, and 'G' allele (OR = 2.42; p = 9.26 × 10) were observed in patients. Reduced frequencies of 'AA' (OR = 0.35; p = 7.19 × 10) and 'A' (OR = 0.41; p = 9.26 × 10) in patients revealed protective association. Among HLA-DRB1*/DQB1* alleles, DRB1*04 (OR = 3.29; p = 1.0 × 10), DRB1*03 (OR = 2.81; p = 1.9 × 10), DQB1*02:01 (OR = 2.93; p = 1.65 × 10), DQB1*02:02 (OR = 3.38; p = 0.0003), and DQB1*03:02 (OR = 7.72; p = 0.0003) were in susceptible association. Decreased frequencies of alleles, DRB1*15 (OR = 0.32; p = 2.55 × 10), DRB1*10 (OR = 0.45; p = 0.002), DQB1*06:01 (OR = 0.43; p = 0.0001), and DQB1*05:02 (OR = 0.28; p = 2.1 × 10) in patients were suggested protective association. The combination of DRB1*03+AG (OR = 5.21; p = 1.4 × 10), DRB1*04+AG (OR = 2.14; p = 0.053), DRB1*04+GG (OR = 5.21; p = 0.036), DQB1*02:01+AG (OR = 4.44; p = 3.6 × 10), DQB1*02:02+AG (OR = 20.9; p = 9.5 × 10), and DQB1*02:02+GG (OR = 4.06; p = 0.036) revealed susceptible association. However, the combination of DRB1*10+AA (OR = 0.35; p = 0.003), DRB1*15+AA (OR = 0.22; p = 5.3 × 10), DQB1*05:01+AA (OR = 0.45; p = 0.007), DQB1*05:02+AA (OR = 0.17; p = 1.7 × 10), DQB1*06:01+AA (OR = 0.40; p = 0.002), and DQB1*06:02+AG (OR = 0.34; p = 0.001) showed decreased frequency in patients, suggesting protective association. In conclusion, CTLA4/HLA-DR/DQ genotypic combinations revealed strong susceptible/protective association toward T1DM in south India. A female preponderance in disease associations was also documented.

Diverse human leukocyte antigen association of type 1 diabetes in north India

“…Therefore, the genotype data suggest that the positive association of DRB1*04 may not be independent of HLA‐DRB1*03 or that it may possibly be a synergistic effect between the predisposing HLA‐DRB1*03 and DRB1*04 alleles or other alleles on their associated haplotypes. This is in contrast to the data from south India, where both DRB1*03 and DRB1*04 contributed equally towards disease predisposition . Further, the protective effect conferred by HLA‐DRB1*15 appeared to be independent of other HLA‐DRB1 alleles, because all the DRB1*15 genotypes (ie, DRB1*15/DRB1*15, DRB1*15/DRB1*04, and DRB1*15/ DRB1*XX) were significantly decreased in T1D patients vs controls.…”

CTLA-4 CT-60 A/G and CTLA-4 1822 C/T Gene Polymorphisms in Indonesians with Type 1 Diabetes Mellitus

“…Polymerase chain reaction (PCR) was performed using specific primers (CTLA-4 CT-60A/G: forward, 5′GATTTCTTCACCACTATTTGGGATATTAC3′ and reverse, 5′AGATCAAAATGGCTGCAAGG3′; CTLA-4 1822 C/T: forward, 5′TCAAAGGGATTGAGCAGATG3′ and reverse, 5′TCCCATGCTC‌TTTGTTCTC3′). 4 , 8 The RLFP analysis of CTLA-4 genes was performed using restriction enzymes BsaAI and BsmAI for CTLA-4 CT-60A/G and CTLA-4 1822 C/T, respectively. 8 …”

“…The following cycling conditions were applied: an initial denaturation of 2 min at 94°C, 35 cycles of annealing for 45 s at 58°C and extension for 1 min at 72°C, and a final extension of 3 min at 72°C. 4 , 8 Approximately 11 μL of each final PCR product was incubated at 37°C for 6 h with 1 U of restriction enzyme at a total volume of 20 µL. 4 , 8 The PCR-RLFP products (11 μL) were separated using 6% acrylamide gel at 5 V/cm for 1 h in 1× TBE (Tris/Borate/EDTA) buffer and observed under UV light (IWASAKI ASAHI TECHNO GLASS).…”

“… 4 , 8 Approximately 11 μL of each final PCR product was incubated at 37°C for 6 h with 1 U of restriction enzyme at a total volume of 20 µL. 4 , 8 The PCR-RLFP products (11 μL) were separated using 6% acrylamide gel at 5 V/cm for 1 h in 1× TBE (Tris/Borate/EDTA) buffer and observed under UV light (IWASAKI ASAHI TECHNO GLASS). The length of PCR-RLFP products evaluated using One Step Marker 9 were as follows: 1) CTLA 4 CT-60 A/G: 203 bp for A/A, 176 bp, and 29 bp for G/G, and both products for A/G genotype and 2) CTLA4 1822 C/T: 102 bp for T/T, 74 bp for C/C, and both products for C/T genotype.…”

“…This mechanism plays an important role in the susceptibility of T1DM. 2 , 4–8 In recent years, many studies related to the genetic and immunological aspects of T1DM pathogenesis have been reported. 9 The polymorphism of CTLA-4 that is related to autoimmune diseases (AITD and T1DM) particularly are CT 60 and CT 1822.…”