Associations Between <i>TIM1</i> Polymorphisms and Dilated Cardiomyopathy in a Han Chinese Population

Abstract

SummaryImmune dysfunction is implicated in dilated cardiomyopathy (DCM). Previous studies found that TIM1 polymorphisms were associated with immune dysfunction. However, the associations between TIM1 polymorphisms and DCM have not been investigated. Therefore, we conducted the present study to evaluate whether TIM1 polymorphisms were associated with DCM in the Han Chinese population. A total of 396 DCM patients and 403 healthy controls were enrolled in this case-control study. Two promoter region single nucleotide polymorphisms (SNPs) of TIM1 gene, -416G>C and -1454G>A, were genotyped by PCR-RFLP. The associations between two SNPs genotyped and the overall survival (OS) of DCM patients were evaluated with Kaplan-Meier analysis and Cox regression analysis. Plasma TIM-1 levels were further measured by ELISA. We found that the C allelic frequency of -416G>C and A allelic frequency of -1454G>A were higher in DCM patients than that in controls (P < 0.001). The genotypic frequencies of both SNPs were associated with DCM susceptibility in the codominant, dominant, and overdominant models (P < 0.01). They were also associated with the OS of DCM patients in the dominant, recessive, and overdominant models (P < 0.001). The CC genotype of -416G>C and AA genotype of -1454G>A were associated with the worst prognosis (P < 0.001). In addition, the plasma TIM-1 levels in DCM patients were higher than that in controls (259.0 pg/mL versus 149.8 pg/mL, P = 0.035). The CC genotype of 416G>C and AA genotype of -1454G>A were associated with the highest TIM-1 production (P < 0.01). Overall, our findings suggest that TIM1 polymorphisms are associated with DCM susceptibility and prognosis in this Han Chinese population. (Int Heart J 2016; 57: 742-746) Key words: Single nucleotide polymorphisms, Survival analysis, Enzyme-linked immunosorbent assay D ilated cardiomyopathy (DCM), characterized by progressive ventricular chamber enlargement and contractional dysfunction in the absence of associated conditions such as hypertension, ischemic heart disease, valvular heart disease, congenital heart disease, and pulmonary heart disease, is the most common type of cardiomyopathy, accounting for approximately 55-60% of cardiomyopathies with an estimated prevalence of 1 in 2,500 individuals.1) It is the leading non-ischemic cause of congestive heart failure and sudden cardiac death, and is the most frequent indication for cardiac transplantation in adults and children. 2)In the last two decades, extensive studies have been conducted to investigate the etiology of DCM. However, the exact cause of the disease is still largely unknown. Recently, immune dysfunction was demonstrated to be involved in the pathogenesis of DCM. Firstly, it was found that T suppressor (Ts) cells are decreased while T helper (Th) cells are increased in DCM patients.3) Secondly, several cardiac-specific antibodies were detected in serum of DCM patients.4-7) And thirdly, immunosuppressive therapy was shown to be associated with symptomatic and functional improvements of DCM...

A Novel Truncating <i>LMNA</i> Mutation in Patients with Cardiac Conduction Disorders and Dilated Cardiomyopathy

“…Several reports have described DCM onset occurring after the age of 40 years. 11,22,31,32) Therefore, long-term follow-up is needed to confirm whether there is a gender difference in this family. In addition, the influence of gender on the clinical severity of inherited cardiovascular disease caused by an autosomal monogenic mutation is still unclear and requires further investigation in a large cohort.…”

Genetic polymorphisms of rs9313422 G>C and rs41297579 G>A at the promoter of TIM‐1 gene contribute to the risk of community‐acquired pneumonia in children

“…In the study by Xie et al, the rs9313422 CC genotype and rs41297579 AA genotype could greatly affect the susceptibility and prognosis of dilated cardiomyopathy, indicating that the gene mutation of rs9313422 G>C and rs41297579 G>A might be a risk factor for multiple diseases along the above evidence, as well as in children with CAP. As we know, both of the two SNPs were located in the promoter region of TIM‐1 , and there was evidence stating that the polymorphisms within promoter regions couldnot change the coding sequence of a specific gene, but they could possibly influence the initiation and promotion of gene transcription, thereby exerting pathogenic effects . More importantly, TIM‐1 was widely accepted as an important pathogenic factor of inflammatory diseases, including pneumonia, which can be selectively expressed on the surface of activated CD4 + T cells, thus promoting the secretion of Th2 cytokines, stimulating the proliferation and activation of B cells, and promoting the production of antibodies (IgE and IgA) .…”

“…Polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) was applied for the genotyping of − 1454 G>A (rs41297579) and −416 G>C (rs9313422) . The primer sequences were listed as follows: rs9313422 G>C: Forward: 5’‐GCATGTTGTACAGGAGCATGA‐3’, Reverse: 5’‐GCAGACAGGCTGGTTGGTACC‐3’ and rs41297579 G>A: Forward: 5’‐ CAGGTTGGTCTCAAACTCCTT‐3’, Reverse 5’‐TTCCAAGGAGGCAGTGGTGG‐3’.…”

“…Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was applied for the genotyping of − 1454 G>A (rs41297579) and −416 G>C (rs9313422). 11 The primer sequences were listed as follows: rs9313422 G>C: Forward: 5'-GCATGTT…”

“…8 For instance, the GG genotype and G allele of −174 G/C in IL-6 (an anti-inflammatory cytokine) had a close relation to the susceptibility of CAP in Egyptian children, as suggested by Zidan et al 9 The human T-cell immunoglobulin mucin (TIM) gene family, located on the human chromosome 5q23-35, contains three members, including TIM-1, TIM-3, and TIM-4, 10 which was shown to be relevant to the immune dysfunction, consequently inducing various diseases, such as autoimmune diseases, allergic diseases, chronic viral infections (CVI), immune rejections, and even tumors. 11 As the first identified gene, TIM-1, also known as HAVCR1, was responsible for regulating immune responses and maintaining immune homeostasis, which had relations to several human inflammatory diseases, 12 and took part in the occurrence and progression of pneumonia. In the study by Fan et al, patients with mycoplasma pneumoniae pneumonia (MPP) were statistically different from healthy controls in the tilters of TIM1, and blocking TIM1 expression may reduce the risk of MPP-induced damages in heart and liver.…”