ASSOCIATION OF POLYMORPHISM rs2569190 OF THE GENE CD14 WITH ANKYLOSING SPONDILITIS

Abstract

Ankylosing spondylitis is a chronic rheumatological disease of unknown etiology. The search for new genetic associations will improve understanding of pathogenesis. Objective: to study the association of the rs2569190 polymorphism of the CD14 gene with ankylosing spondylitis in the European population of the Krasnoyarsk region. The study recruited 3 groups of patients: the first - with ankylosing spondylitis (AS) (n = 150), the second group - patients with the rest of seronegative spondyloarthritis (SPA) (n = 66), the third group included conditionally healthy patients (control group) (n = 226). The clinical assessment of patients with SPA was based on Russian federal clinical guidelines, including the calculation of the BASDAI, BASFI and HAQ indices. DNA isolation was performed using the standard phenol-chloroform method. Genotyping for the CD14 gene was performed by PCR (polymerase chain reaction) – RFLP (restriction fragment length polymorphism) analysis. PCR was performed with a set of primers (forward GCTGAGGTTCGGAGAAGTTGC; reverse GGTGCCAACAGATGAGGTTCAC) followed by restriction with Bme18I. PCR products were analyzed by electrophoresis in 4% polyacrylamide gel followed by staining with ethidium bromide. Comparative analysis of the group of patients with AS and the control group revealed a statistically significant prevalence of the TT genotype rs2569190 in the main group (34.7% versus 23.9%) (p = 0.0236; OR 1.6901; 95% CI OR 1.0728-2.6625). Patients with seronegative SPA did not demonstrate the significant disparities in rs2569190. In Krasnoyarsk region europids, the TT genotype of the rs2569190 polymorphism was associated with ankylosing spondylitis but not with seronegative SPA. The identification of a new association confirms the influence of other genetic factors on the predisposition to AS. It is likely that some of the genetic factors play a role in the pathogenesis under the influence of the external environment. Identification of these associations will make it possible to adjust the lifestyle of patients and their relatives to reduce the risk of exacerbation or development of AS.