Association of Genetic Polymorphism of Inflammatory Genes (IL-1β and IL-4) with Diabetes Type 2

Biochemical and molecular study on interleukin‐1β gene expression and relation of single nucleotide polymorphism in promoter region with Type 2 diabetes mellitus

“…However, previous studies carried in Indian population showed association of IL1β TT genotype and T allele with higher risk of diabetes the discrepancy of risk allele might be attributed to ethnic variation, genetic background, and environmental determinants.…”

“…Moreover, the gene transcript of IL1-β was dominantly higher in T2DM than healthy subjects which prove the possible immune modulating role of IL1-β in T2DM. Interestingly, C/C genotype of IL1-β −511 T>C polymorphism, was associated with risk of developing diabetes and glucose homeostasis in Finnish population Luotola et al 25 with risk of silent myocardial infarction in diabetic patients, Vargas-Alarcón et al 21 with ulcerative colitis in Mexican population Yamamoto-Furusho et al 17 with risk of coronary artery disease Rechciński et al 26 and with a higher susceptibility to febrile seizures in Egyptian children Abdel Rasol et al 27 However, previous studies carried in Indian population showed association of IL1β TT genotype and T allele with higher risk of diabetes 20,28 the discrepancy of risk allele might be attributed to ethnic variation, genetic background, and environmental determinants.…”

“…15,16 The IL-1 β −511 T>C single nucleotide polymorphism (SNP) in the promoter region has been identified in the 5′−flanking region of the IL-1 β gene, this SNP has been related with the promoter activity, and with risk of diseases including ulcerative colitis, diabetes nephropathy, rheumatoid arthritis, T2DM, and myocardial infarction. [17][18][19][20][21] Past studies indicated controversial outcomes about association of interleukin-1β with T2DM so we pointed in this research to investigate gene expression of Interleukin-1β and its connection with SNP in its promoter region at position −511 (rs16944) and its conceivable relation with susceptibility to T2DM in Egyptian patients.…”

Association between IL1 gene polymorphism and human African trypanosomiasis in populations of sleeping sickness foci of southern Cameroon

“…The polymorphic locus rs2234663 within IL1RN was selected for its association with H . Pylori gastric infections in Brazil [36] while rs79071878- IL4RN within IL4R gene was due to its association with type II diabetes in India [37]. HP1/2 VNTR allele of the HP gene was selected based on its associations with malaria [36].…”

“…The 70 bp tandem repeat (rs79071878) region of IL4RN gene was amplified with IL4-70 bp-F (AGGCTGAAAGGGGGAAAGC) and IL4-70 bp-R (CTGTTCACCTCAACTGCTCC) primers [37] while the 86bp tandem repeat (rs2234663) of IL1RN gene was amplified with IL1RN-F (CTCAGCAACACTCCTAT) and IL1RN-R (TCCTGGTCTGCAGGTAA) primers as described by Santos et al . [36].…”