Association between polymorphisms in interleukin‐17A and interleukin‐17F genes and risks of gastric cancer

Abstract

Chronic inflammation is the hallmark of the pathogenesis of Helicobacter pylori-induced gastric cancer. Interleukin (IL)-17A and IL-17F are inflammatory cytokines expressed by a novel subset of CD41 Th cells and play critical function in inflammation and probably in cancer. We conducted a case-control study including 1,010 gastric cancer patients and 800 healthy controls to assess the association between IL-17A G197A and IL-17F A7488G polymorphisms and risk of gastric cancer. Genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing. Logistic regression and Cox-proportional hazards analyses were used to evaluate the associations between polymorphisms and gastric cancer susceptibility, clinicopathological features and survival. After adjusted for age and gender, IL-17F 7488GA and GG genotypes were associated with an increased risk of gastric cancer compared with AA genotype [OR 1.51, 95% confidence interval (CI): 1.22-1.87 for GA; OR 1.61, 95% CI: 1.03-2.51 for GG]. Further stratification analyses indicated that the effect of IL-17F 7488GA genotype was noteworthy in gastric cancer patients of noncardia, intestinal type, poorly and moderately differentiated, age older than 40, large tumor size and lymph node metastasis. IL-17A 197AG genotype was associated with increased risk of poorly differentiated, TNM I/II, age of 40-65-year subtypes of gastric cancer, but not with total gastric cancer risk (p 5 0.098). No significant relationship was observed between polymorphisms and survival of gastric cancer patients. These findings suggest that polymorphism of IL-17F 7488 involved in susceptibility to gastric cancer, which also influenced certain subtypes according to clinicopathological features, whereas IL-17A 197 may be less relevant.

Il-17 Genetic and Immunophenotypic Evaluation in Chronic Graft-Versus-Host Disease

“…Until now, no other work was reported in the literature relating IL17F polymorphism and GVHD. We did not find association between IL17F genotypes and cGVHD; however other authors showed association between IL17F polymorphism (T/C 7488) and Behçet disease [21], gastric cancer [14], and bone mineral density [22].…”

“…The sequences of PCR primers for IL17A were reverse 5 AACAAGTAA-GAATGAAAAGAGGACATGGT 3 and ant-sense 5 CCC-CCAAATGAGGTCATAGAAGAGAATC 3 and for IL17F were reverse 5 GTTCCCATCCAGCAAGAGAC 3 and antsense 5 AGCTGGGAATGCAAACAAAC 3 , as previously described [14,15]. The PCR was carried out in a total volume of 50 L, containing approximately 400 ng of DNA, primers (20 pmol/reaction), and 25 L of premix buffer (Phoneutria Biotecnologia, Belo Horizonte, Brazil).…”

Role ofHelicobacter pyloriinfection in pathogenesis of gastric carcinoma

“…IL17 A/F plays critical function in inflammation and probably in cancer. Studies concluded that polymorphism of IL17F was involved in suscepti bility to GC [87] . Current evidences support that TLRs are play roles in both recognition of H. pylori and gastric carcinogenesis, and polymorphisms in genes involved in the TLR signaling pathways modulate the risk of GC [88] .…”

Association between the Interleukin-17A -197G>A (rs2275913) Polymorphism and Risk of Digestive Cancer

“…According to the inclusion and exclusion criteria, nine articles were finally included in this meta-analysis (Wu et al, 2010;Arisawa et al, 2012;Rafiei et al, 2013;Gonzalez-Hormazabal et al, 2014;Kutikhin et al, 2014;Omrane et al, 2014;Qinghai et al, 2014;Wang et al, 2014;Yin et al, 2014). The flow process of literature search and study identification was shown in Figure 1.…”

“…To date, several case-control studies have been carried out to investigate the role of IL-17A -197G>A polymorphism in predisposition to various cancers, including gastric, bladder, lung, colorectal, breast, cervical, ovarian, esophageal and hepatocellular cancer (Wu et al, 2010;Arisawa et al, 2012;Quan et al, 2012;Wang et al, 2012a;Rafiei et al, 2013;Zhou et al, 2013;Kaabachi et al, 2014;Kutikhin et al, 2014;Li et al, 2014;Qinghai et al, 2014;Yin et al, 2014). Several metaanalyses have been conducted to evaluate the association between IL-17A polymorphisms and cancer risk (Dai et al, 2014;Zhao et al, 2014); nevertheless, the association between IL-17A polymorphism and digestive cancer risk has not been assessed.…”