Assessment of the Bacteriocinogenic Potential of Marine Bacteria Reveals Lichenicidin Production by Seaweed-Derived Bacillus spp.

Abstract

The objectives of this study were (1) to assess the bacteriocinogenic potential of bacteria derived mainly from seaweed, but also sand and seawater, (2) to identify at least some of the bacteriocins produced, if any and (3) to determine if they are unique to the marine environment and/or novel. Fifteen Bacillus licheniformis or pumilus isolates with antimicrobial activity against at least one of the indicator bacteria used were recovered. Some, at least, of the antimicrobials produced were bacteriocins, as they were proteinaceous and the producers displayed immunity. Screening with PCR primers for known Bacillus bacteriocins revealed that three seaweed-derived Bacillus licheniformis harbored the bli04127 gene which encodes one of the peptides of the two-peptide lantibiotic lichenicidin. Production of both lichenicidin peptides was then confirmed by mass spectrometry. This is the first definitive proof of bacteriocin production by seaweed-derived bacteria. The authors acknowledge that the bacteriocin produced has previously been discovered and is not unique to the marine environment. However, the other marine isolates likely produce novel bacteriocins, as none harboured genes for known Bacillus bacteriocins.

In Vitro Assessment of Marine Bacillus for Use as Livestock Probiotics

“…However, all of the marine isolates previously showed activity against E. coli DSM 10720 on solid media [20] but only one ( B. pumilus WIT 588) reduced counts of this E. coli strain in liquid culture. This may be explained by the fact that the antimicrobial(s) seems not to be released from the bacterial cells.…”

“…B. licheniformis and B. subtilis were isolated from the Bioplus 2B ® animal probiotic product (Chr. Hansen, Hørsholm, Denmark) and their identity confirmed by 16S rRNA gene sequencing, as outlined previously [20]. PFGE fingerprints of the Rif r variants of the marine bacteria were also compared with those of the Bioplus 2B ® isolates.…”

Inhibition ofListeria monocytogenesbiofilms by bacteriocin-producing bacteria isolated from mushroom substrate

“…)); Bli04127 for lichenicidin (215 bp, F: 5′‐GGAAATGATTCTTTCATGG‐3′, R: 5′‐TTAGTTACAGCTTGGCATG‐3′ (Prieto et al . )) and SubA for subtilomycin (968 bp, subA2569‐F: 5′‐TGCGGATGACAGATTCGTATTGC‐3′, subA2571‐R: 5′‐ACAGCTGTACCGTGCCCATATAGA‐3′ (Phelan et al . )).…”

Lichenicidin rational site‐directed mutagenesis library: A tool to generate bioengineered lantibiotics

“…Lichenicidin is a two‐peptide lantibiotic naturally produced by Bacillus licheniformis strains (Begley, Cotter, Hill, & Ross, ; Caetano, Krawczyk, Mösker, Süssmuth, & Mendo, ; Dischinger, Josten, Szekat, Sahl, & Bierbaum, ; Mendo, Faustino, Sarmento, Amado, & Moir, ; Prieto et al, ; Shenkarev et al, ). Bioactivity against target strains results from the synergistic activity of the two peptides, Bliα and Bliβ (Shenkarev et al, ).…”