Assessment of species distributions in <i>Pleurotus</i> based on trapping of airborne basidiospores

Vilgalys, Rytas; Sun, Bao Lin

doi:10.1080/00275514.1994.12026407

Cited by 20 publications

(10 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A higher success rate in trapping dikaryons of S. commune was found relative to spore trapping of Pleurotu s spp. (Vilgalys & Sun 1994b), although technical differences prevent the two rates from being compared directly. The sedimentation rate of spores recorded in this study (18.24 spores/m 2 /h) is lower than that recovered for another common mushroom species, Coriolus versicolor , in which 636 dikaryons were obtained over 660 h of sampling, providing an estimated sedimentation rate of (112.92 spores/m 2 /h; Williams et al .…”

Section: Discussionmentioning

confidence: 99%

“…For mycologists studying mushroom‐forming basidiomycetes, there exists a novel method for obtaining large population samples from spores settling from the air (Adams et al . 1984; Vilgalys & Sun 1994b). This method employs a homokaryotic (genetically haploid) strain of a given species as bait for selectively extracting spores of the same species from the air.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Abundance and diversity of Schizophyllum commune spore clouds in the Caribbean detected by selective sampling

James

Vilgalys

2001

Molecular Ecology

Self Cite

View full text Add to dashboard Cite

Selective spore trapping and molecular genotyping methods were employed to examine potential long‐distance gene flow among Caribbean populations of the common mushroom Schizophyllum commune. Spore‐trap samples from five locations were analysed using restriction fragment polymorphisms of five enzymatically amplified gene regions. Successful trappings suggested S. commune spores to be abundant in the air, with an estimated sedimentation rate of ≈ 18 spores/m2/h. High levels of genetic diversity characterized the spore‐trap samples, with as many as 12 alleles observed at a single locus (chitin synthase) over all samples. In addition, spore‐trap samples showed significant among sample heterogeneity including geographical population substructure. The ribosomal DNA (rDNA) intergenic spacer displayed the greatest allele frequency differences among samples, clearly separating the samples into those possessing only a South American‐type allele and those segregating for both North and South American‐type alleles. The molecular variation provided no clear evidence for dispersal over large, aquatic barriers within the Caribbean region, and instead suggested that spore‐trapping experiments are primarily reflective of the local, established population.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Abundance and diversity of Schizophyllum commune spore clouds in the Caribbean detected by selective sampling

James

Vilgalys

2001

Molecular Ecology

Self Cite

View full text Add to dashboard Cite

show abstract

“…We designed the primer pair used to amplify the nuclear ribosomal small subunit (nrSSU) as nrSSU-CoF (TCTCAAAGATTAAGCCATGC) and nrSSU-CoR (TCACCAACGGAGACCTTG). Two primer pairs, LR5 and LR0R (Vilgalys & Sun 1994), EF1α-EF and EF1α-ER (Bischoff et al 2006;Sung et al 2007) were used to amplify the nuclear ribosomal large subunit (nrLSU) and the translation elongation factor 1α (tef-1α), respectively. The largest and second largest subunits of RNA polymerase ІІ (rpb1and rpb2) were amplified using the two primer pairs RPB1-5′F and RPB1-5′R and RPB2-5′F and RPB2-5′R, respectively (Bischoff et al 2006;Sung et al 2007).…”

Section: Dna Extraction Pcr and Sequencingmentioning

confidence: 99%

Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China

Wang

Dai

et al. 2015

Mycol Progress

View full text Add to dashboard Cite

A new species, Polycephalomyces agaricus, which is parasitic on Ophiocordyceps sp., a pathogen of melolonthid larvae in southwestern China, is described using morphological and phylogenetic evidence. This species differs morphologically from other species in the genus by its agaric-shaped synnemata, pileus-like slimy masses on short stipes, globose to subglobose α-conidia, and plenty of laterally or apically proliferating phialides. The phylogenetic analyses based on 5-locus (nrSSU, nrLSU, tef-1α, rpb1, and rpb2) data strongly support that this fungus is a distinct species in the genus.

show abstract

“…Several successful investigations have repeated this method (e.g. Vilgalys & Sun 1994, Nordtn & Larsson 2000, which is very simple but also one of the few available methods to detect airborne fungal spores on a species-specific level. In this way, occurrence of conspecific spores will be recorded even if their density is extremely low.…”

Section: Introductionmentioning

confidence: 99%

Long‐distance spore dispersal in wood‐inhabiting Basidiomycetes

Hallenberg

Küffer

2001

Nordic Journal of Botany

View full text Add to dashboard Cite

N. 2001. Long-distance spore dispersal in wood-inhabiting Basidiomycetes. -Nord. J. Bot. 21: 431-436. Copenhagen. ISSN 0107-055X. Eight species of wood-inhabiting basidiomycetes (Laurilia sulcata, Peniophora aurantiaca. Resinicium bicolol: Scytinostroma galactinum, Terana caerulea,Trichaptum abietinum, Z biforme and Z fuscoviolaceum) were used in a spore-trapping test to evaluate their individual ability for long-distance spore dispersal. Petri dishes with single spore mycelia were used as baits. In the experiment, carried out at the Botanical Institute in Goteborg, spores from the air were regularly captured. Surprisingly, spores were captured from species whose nearest known natural occurrence was located quite far from Goteborg. The closest population of Peniophora aurantiaca is about 1000 km south of Goteborg. The results from this experiment support the hypothesis that fungal spores are widely and efficiently dispersed. Such a broad and extensive dispersal ability is of vital importance, especially for wood-inhabiting species which are highly dependent on a substrate which is only temporarily available.

show abstract

Assessment of species distributions in Pleurotus based on trapping of airborne basidiospores

Cited by 20 publications

References 7 publications

Abundance and diversity of Schizophyllum commune spore clouds in the Caribbean detected by selective sampling

Abundance and diversity of Schizophyllum commune spore clouds in the Caribbean detected by selective sampling

Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China

Long‐distance spore dispersal in wood‐inhabiting Basidiomycetes

Contact Info

Product

Resources

About