Assays for Evaluation of HIV‐1 Integrase Enzymatic Activity, DNA Binding, and Cofactor Interaction

Christ, Frauke; Busschots, Katrien; Hendrix, Jelle; McNeely, Melissa; Engelborghs, Yves; Debyser, Zeger

doi:10.1002/9781118015377.ch12

Cited by 4 publications

(7 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The blockage percentage of syncytia formation was calculated by the percentage of syncytia number in the sample being treated compared to the percentage in the control being infected. An effective concentration of 50 percent (EC50) was calculated 16 .…”

Section: In-vitro Assaysmentioning

confidence: 99%

Untitled

2020

IJPSR

View full text Add to dashboard Cite

A progression of fourteen narrative quinolonyl diketo acid analogs were planned, synthesized, identified by IR, NMR, CHN and MS supernatural analysis and evaluated as potential HIV-1 Integrase hinders. Compounds of Zinc database were surfed considering Elvitegravir as standard. Nearly 99 compounds were identified and docked in the active site of HIV-1 integrase. Molecular docking study of compounds 1, 4 and 7 showed docking score -10.38, -9.31 and -10.12 respectively as that of set drug Elvitegravir -4.93. The docking poses to open the interaction of the ligands with preferred amino acids. The standard drug Elvitegravir displayed connections with lys156, Asn155, Lys159 and Thr66. Raltegravir showed hydrogen bonding with Asp 116. A round fourteen target diketoquinolines were chosen for advance synthesis with the help of substituted oxoquinoline-3-carboxylate as starting material. Invitro biological evaluation open that some of the upper-class compounds exhibited moderate to good inhibitory activity besides HIV1 Integrase compared to the reference drugs Raltegravir and Nevirapine. Compounds 1, 2, 3 and 4 weakly inhibited HIV-1 integrase at EC50 of 0.31, 0.25, 0.22 & 0.21 with the therapeutic index 242, 260, 266 and 278 respectively. The cytotoxicity of upperclass compounds on C8166 cells was very low, the CC50 value was higher than 200 μM, except for few compounds. As an optimistic control drug, Nevirapine showed significant anti-HIV-1 activity (EC50 = 0.015~0.016 μM) in-vitro, and the CC50 was higher than 200 μM, with a therapeutic index value of 12418.50. Compound 14 exhibited significant inhibition of HIV-1 syncytium and integrase at EC50 0.25 and 0.12 respectively.

show abstract

Section: In-vitro Assaysmentioning

confidence: 99%

Untitled

2020

IJPSR

View full text Add to dashboard Cite

show abstract

“…The enzymatic integration reactions were carried out with minor modifications as described previously [43,44]. To determine the susceptibility of the HIV-1 IN enzyme to different compounds, an enzyme-linked immunosorbent assay (ELISA) adapted from Hwang et al was used [45].…”

Section: Integrase Assaysmentioning

confidence: 99%

“…Reaction products were denatured with 30 mM NaOH and detected by ELISA on avidin-coated plates. For determining the effect of compounds on the 3′-processing activity a classical cleavage assay with detection of products by denaturating gel electrophoresis was performed as described [43,44]. Briefly, 0.2 pmol of the radioactively labeled oligonucleotide substrate (INT1, 32 P-5′-TGTGGAAAATCTCTAGCAGT-3′; INT2, 5′-ACTGCTAGAGATTTTCCACA-3′) and 10 nmol IN in a final volume of 10 µL was incubated for 1 h at 37 °C.…”

Section: Integrase Assaysmentioning

confidence: 99%

Synthesis, Molecular Modelling and Biological Studies of 3-hydroxypyrane- 4-one and 3-hydroxy-pyridine-4-one Derivatives as HIV-1 Integrase Inhibitors

Sirous

Fassihi

Brogi

et al. 2019

Self Cite

View full text Add to dashboard Cite

Background: Despite the progress in the discovery of antiretroviral compounds for treating HIV-1 infection by targeting HIV integrase (IN), a promising and well-known drug target against HIV-1, there is a growing need to increase the armamentarium against HIV, for avoiding the drug resistance issue. Objective: To develop novel HIV-1 IN inhibitors, a series of 3-hydroxy-pyrane-4-one (HP) and 3- hydroxy-pyridine-4-one (HPO) derivatives have been rationally designed and synthesized. Methods: To provide a significant characterization of the novel compounds, in-depth computational analysis was performed using a novel HIV-1 IN/DNA binary 3D-model for investigating the binding mode of the newly conceived molecules in complex with IN. The 3D-model was generated using the proto-type foamy virus (PFV) DNA as a structural template, positioning the viral polydesoxyribonucleic chain into the HIV-1 IN homology model. Moreover, a series of in vitro tests were performed including HIV-1 activity inhibition, HIV-1 IN activity inhibition, HIV-1 IN strand transfer activity inhibition and cellular toxicity. Results: Bioassay results indicated that most of HP analogues including HPa, HPb, HPc, HPd, HPe and HPg, showed favorable inhibitory activities against HIV-1-IN in the low micromolar range. Particularly halogenated derivatives (HPb and HPd) offered the best biological activities in terms of reduced toxicity and optimum inhibitory activities against HIV-1 IN and HIV-1 in cell culture. Conclusion: Halogenated derivatives, HPb and HPd, displayed the most promising anti-HIV profile, paving the way to the optimization of the presented scaffolds for developing new effective antiviral agents.

show abstract

“…The inhibitory percentage of syncytia formation was calculated by the percentage of syncytia number in treated sample compared to that in infected control. 50 % effective concentration (EC50) was calculated [10].…”

Section: Inhibition Of Syncytia Formationmentioning

confidence: 99%

“…Reaction products were denatured with 30 mM NaOH and detected by ELISA on avidin-coated plates. For determining the effect of compounds on the 3'processing activity a classical cleavage assay with detection of products by denaturating gelelectrophoresis was performed as described previousluy [10,11]. Briefly, 0.2 pmol of the radioactive labeled oligonucleotide substrate (INT1, 32 P-5' TGTGGAAAATCTCTAGCAGT 3'; INT2,5'-ACTGCTAGAGATTTTCCACA 3') and 10 nmol integrase in a final volume of 10 µL was incubated for 1 h at 37°C.…”

Section: Inhibition Of Syncytia Formationmentioning

confidence: 99%

Docking, Synthesis and Biological Evaluation of Novel Diketoquinoline Analogues as HIV-1 Integrase Inhibitor

et al. 2019

View full text Add to dashboard Cite

A series of novel diketoquinoline acid derivatives as potential anti-HIV-1 Integrase inhibitors were docked, synthesized and characterized by IR, NMR , CHN and MS spectral analysis. Many compounds were identified and docked in integrase pocket. The target diketoquinolines were prepared from substituted oxoquinoline-3-carboxylate. In vitro biological evaluation revealed that some of the titled compounds exhibited moderate to good anti-HIV-1 Integrase inhibitory activity in comparison with the reference drugs i.e. raltegravir and nevirapine. The cytotoxicity of most of testing compounds on C8166 were very low, the CC50 value of them were higher than 200 μM, except the few compounds. Compounds 1-5 showed weak anti-HIV-1 activity, its therapeutic index was 457, 531, 583, 869 and 909 respectively. As a positive control drug, Nevirapine has the best anti-HIV-1 activity (EC50 = 0.015-0.016 μM) in vitro and the CC50 of was higher than 200 μM, its therapeutic index was higher 12418.50. In integrase assay compound 6 and 7 showed EC50 value 0.08 μM as compared with standard drug raltegravir.

show abstract

Assays for Evaluation of HIV‐1 Integrase Enzymatic Activity, DNA Binding, and Cofactor Interaction

Cited by 4 publications

References 66 publications

Untitled

Untitled

Synthesis, Molecular Modelling and Biological Studies of 3-hydroxypyrane- 4-one and 3-hydroxy-pyridine-4-one Derivatives as HIV-1 Integrase Inhibitors

Docking, Synthesis and Biological Evaluation of Novel Diketoquinoline Analogues as HIV-1 Integrase Inhibitor

Contact Info

Product

Resources

About