ASPM promotes ATR-CHK1 activation and stabilizes stalled replication forks in response to replication stress

Wu, Xingxuan; Xu, Shibin; Wang, Peipei; Wang, Zhao‐Qi; Chen, Hongxiang; Xu, Xingzhi; Peng, Bin

doi:10.1073/pnas.2203783119

Cited by 8 publications

(6 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…ssDNA/dsDNA pulldown assays were performed as previously described [26] . In brief, biotinylated DNA oligomers (sense strand: 5′-AACCTGTCGTGCCAGCTGCA-biotin-3′; anti-sense strand: 5′-TGCAGCTGGCACGACAGGTTTTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCGCAG CGAGTC-3′) were annealed to generate ssDNA/dsDNA.…”

Section: Methodsmentioning

confidence: 99%

RBM14 promotes DNA end resection during homologous recombination repair

Zheng¹,

Liao²,

Tang³

et al. 2023

ABBS

Self Cite

View full text Add to dashboard Cite

DNA double-strand break (DSB) repair by homologous recombination (HR) is crucial for the maintenance of genome stability and integrity. In this study, we aim to identify novel RNA binding proteins (RBPs) involved in HR repair because little is known about RBP function in HR. For this purpose, we carry out pulldown assays using a synthetic ssDNA/dsDNA structure coated with replication protein A (RPA) to mimic resected DNA, a crucial intermediate in HR-mediated DSB repair. Using this approach, we identify RNA-binding motif protein 14 (RBM14) as a potential binding partner. We further show that RBM14 interacts with an essential HR repair factor, CtIP. RBM14 is crucial for CtIP recruitment to DSB sites and for subsequent RPA coating and RAD51 replacement, facilitating efficient HR repair. Moreover, inhibition of RBM14 expression sensitizes cancer cells to X-ray irradiation. Together, our results demonstrate that RBM14 promotes DNA end resection to ensure HR repair and may serve as a potential target for cancer therapy.

show abstract

Section: Methodsmentioning

confidence: 99%

RBM14 promotes DNA end resection during homologous recombination repair

Zheng¹,

Liao²,

Tang³

et al. 2023

ABBS

Self Cite

View full text Add to dashboard Cite

show abstract

“…Affinity purification experiments showed that FLAG-GFP-ASPM interacts with several proteins involved in DNA replication, including the five subunits of the replication factor complex (RFC1-5), the BRCA2 factor involved in both DSB repair and protection of the replication forks, the MCM5 core subunit of the MCM complex that promotes double-strand DNA unwinding at the replication origins, the TopBP1 topoisomerase, and the RAD9 and RAD17 factors that together with TopBP1 associate to the replication forks, facilitating activation of the ATR-CHK1 kinases [ 80 ]. Despite its multiple interactions with the DNA replication machinery, ASPM is dispensable for DNA replication under unperturbed conditions [ 80 ]. However, after replication stress by either hydroxyurea or aphidicolin, ASPM shields the nascent DNA strand from MR11-mediated degradation at the stalled replication forks, thus preventing genomic instability [ 80 ].…”

Section: Asp/aspm Functions In Interphase Nucleimentioning

confidence: 99%

“…Despite its multiple interactions with the DNA replication machinery, ASPM is dispensable for DNA replication under unperturbed conditions [ 80 ]. However, after replication stress by either hydroxyurea or aphidicolin, ASPM shields the nascent DNA strand from MR11-mediated degradation at the stalled replication forks, thus preventing genomic instability [ 80 ].…”

Section: Asp/aspm Functions In Interphase Nucleimentioning

confidence: 99%

The Multiple Mitotic Roles of the ASPM Orthologous Proteins: Insight into the Etiology of ASPM-Dependent Microcephaly

Razuvaeva

Graziadio

Palumbo

et al. 2023

Cells

View full text Add to dashboard Cite

The Drosophila abnormal spindle (asp) gene was discovered about 40 years ago and shown to be required for both mitotic and meiotic cell division. Subsequent studies showed that asp is highly conserved and that mutations in its human ortholog ASPM (Abnormal Spindle-like Microcephaly-associated; or MCPH5) are the most common cause of autosomal recessive primary microcephaly. This finding greatly stimulated research on ASPM and its fly and mouse (Aspm) orthologs. The three Asp orthologous proteins bind the microtubules (MTs) minus ends during cell division and also function in interphase nuclei. Investigations on different cell types showed that Asp/Aspm/ASPM depletion disrupts one or more of the following mitotic processes: aster formation, spindle pole focusing, centrosome-spindle coupling, spindle orientation, metaphase-to-anaphase progression, chromosome segregation, and cytokinesis. In addition, ASPM physically interacts with components of the DNA repair and replication machineries and is required for the maintenance of chromosomal DNA stability. We propose the working hypothesis that the asp/Aspm/ASPM genes play the same conserved functions in Drosophila, mouse, and human cells. Human microcephaly is a genetically heterogeneous disorder caused by mutations in 30 different genes that play a variety of functions required for cell division and chromosomal DNA integrity. Our hypothesis postulates that ASPM recapitulates the functions of most human microcephaly genes and provides a justification for why ASPM is the most frequently mutated gene in autosomal recessive primary microcephaly.

show abstract

“…Specifically, it has recently been found that ASPM can be recruited to DNA damage sites and is required for efficient homologous recombination repair ( Xu et al, 2021 ). Moreover, ASPM is involved in stabilization of stalled fork in response to replication stress ( Wu et al, 2022 ). Accordingly, ASPM disruption leads to increased DNA damage in cerebellar progenitor cells ( Williams et al, 2015 ).…”

Section: Mechanisms Of Tp53 Activation In Mcph: Dna Damage and Beyondmentioning

confidence: 99%

The impact of TP53 activation and apoptosis in primary hereditary microcephaly

et al. 2023

View full text Add to dashboard Cite

Autosomal recessive primary microcephaly (MCPH) is a constellation of disorders that share significant brain size reduction and mild to moderate intellectual disability, which may be accompanied by a large variety of more invalidating clinical signs. Extensive neural progenitor cells (NPC) proliferation and differentiation are essential to determine brain final size. Accordingly, the 30 MCPH loci mapped so far (MCPH1-MCPH30) encode for proteins involved in microtubule and spindle organization, centriole biogenesis, nuclear envelope, DNA replication and repair, underscoring that a wide variety of cellular processes is required for sustaining NPC expansion during development. Current models propose that altered balance between symmetric and asymmetric division, as well as premature differentiation, are the main mechanisms leading to MCPH. Although studies of cellular alterations in microcephaly models have constantly shown the co-existence of high DNA damage and apoptosis levels, these mechanisms are less considered as primary factors. In this review we highlight how the molecular and cellular events produced by mutation of the majority of MCPH genes may converge on apoptotic death of NPCs and neurons, via TP53 activation. We propose that these mechanisms should be more carefully considered in the alterations of the sophisticated equilibrium between proliferation, differentiation and death produced by MCPH gene mutations. In consideration of the potential druggability of cell apoptotic pathways, a better understanding of their role in MCPH may significantly facilitate the development of translational approaches.

show abstract

ASPM promotes ATR-CHK1 activation and stabilizes stalled replication forks in response to replication stress

Cited by 8 publications

References 70 publications

RBM14 promotes DNA end resection during homologous recombination repair

RBM14 promotes DNA end resection during homologous recombination repair

The Multiple Mitotic Roles of the ASPM Orthologous Proteins: Insight into the Etiology of ASPM-Dependent Microcephaly

The impact of TP53 activation and apoptosis in primary hereditary microcephaly

Contact Info

Product

Resources

About