Asociación entre infección por Fusobacterium nucleatum y cáncer colorrectal: un estudio mexicano

Cuellar-Gomez, Hugo; Ocharan-Hernández, María Esther; Calzada‐Mendoza, Claudia C.; Comoto-Santacruz, David Alberto

doi:10.1016/j.rgmx.2020.12.002

Cited by 2 publications

(1 citation statement)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The used GAPDH forward primer is 5′- GTCTCCTCTGACTTCAACAGCG -3′ and reverse primer is 5′- ACCACCCTGTTGCTGTAGCCAA – 3′. 17…”

Section: Methodsmentioning

confidence: 99%

Study of Long Non-Coding RNA Tug1 Expression in Egyptian Colorectal Adenocarcinoma Patients

Amin,

Ketat,

Kamal

et al. 2023

Journal of Coloproctology

View full text Add to dashboard Cite

Purpose Colorectal cancer (CRC) is one of the most fatal tumors worldwide. In Egypt, most CRC cases occur in individuals > 40 years old. TUG1 has been proved to be disrupted in different malignancies and may have a critical role in tumor progression, invasion, and metastasis. However, its role in CRC has not been adequately studied. Materials / Methods Quantitative real-time polymerase chain reaction (PCR) was used to evaluate the expression levels of long non-coding RNA (LncRNA) taurine upregulated gene 1 (TUG1), in nonmetastatic and metastatic CRC tissues and adjacent noncancerous tissues as control. Results LncRNA TUG1 expression was significantly upregulated in both nonmetastatic and metastatic CRC tissues, in comparison with the adjacent noncancerous tissue. It was found that TUG1 could have a possible prognostic role in CRC, by comparing the sensitivity and specificity of TUG1 with those of CEA and CA19–9. Conclusion The results of the current study suggest that the LncRNA TUG1 participates in the malignant behaviors of CRC cells.

show abstract

“…The used GAPDH forward primer is 5′- GTCTCCTCTGACTTCAACAGCG -3′ and reverse primer is 5′- ACCACCCTGTTGCTGTAGCCAA – 3′. 17…”

Section: Methodsmentioning

confidence: 99%

Study of Long Non-Coding RNA Tug1 Expression in Egyptian Colorectal Adenocarcinoma Patients

Amin,

Ketat,

Kamal

et al. 2023

Journal of Coloproctology

View full text Add to dashboard Cite

show abstract

A rapid and sensitive CRISPR-Cas12a for the detection of Fusobacterium nucleatum

Qu,

Zhang,

et al. 2024

Microbiol Spectr

View full text Add to dashboard Cite

Fusobacterium nucleatum (Fn), as a conditional pathogen, can cause a range of oral and gastrointestinal diseases. However, existing clinical detection methods require expensive equipment and complex procedures, which are inconvenient for large-scale screening in epidemiological research. The purpose of this study was to establish a reliable, rapid, and inexpensive detection method based on CRISPR/Cas12a technology for the detection of Fn. Specific recombinase polymerase amplification (RPA) primer sequences and crRNA sequences were designed based on the nusG gene of Fn. Subsequently, a fluorescence assay and a lateral flow immunoassay were established using the RPA and CRISPR-Cas12a system (RPA-CRISPR-Cas12a). Sensitivity validation revealed a limit of detection of 5 copies/µL. This method could distinguish Fn from other pathogens with excellent specificity. Furthermore, the RPA-CRISPR-Cas12a assay was highly consistent with the classical quantitative real-time PCR method when testing periodontal pocket samples. This makes it a promising method for the detection of Fn and has the potential to play an increasingly important role in infectious disease testing. IMPORTANCE Fusobacterium nucleatum (Fn) naturally exists in the microbial communities of the oral and gastrointestinal tracts of healthy individuals and can cause inflammatory diseases in the oral and gastrointestinal tracts. Recent studies have shown that Fn is closely associated with the occurrence and development of gastrointestinal cancer. Therefore, the detection of Fn is very important. Unlike the existing clinical detection methods, this study established a fluorescence-based assay and lateral flow immunoassay based on the RPA and CRISPR-Cas12a system (RPA-CRISPR-Cas12a), which is fast, reliable, and inexpensive and can complete the detection within 30–40 minutes. This makes it a promising method for the detection of Fn and has the potential to play an increasingly important role in infectious disease testing.

show abstract

Asociación entre infección por Fusobacterium nucleatum y cáncer colorrectal: un estudio mexicano

Cited by 2 publications

References 39 publications

Study of Long Non-Coding RNA Tug1 Expression in Egyptian Colorectal Adenocarcinoma Patients

Study of Long Non-Coding RNA Tug1 Expression in Egyptian Colorectal Adenocarcinoma Patients

A rapid and sensitive CRISPR-Cas12a for the detection of Fusobacterium nucleatum

Contact Info

Product

Resources

About