Array-based DNA methylation profiling in male infertility reveals allele-specific DNA methylation in PIWIL1 and PIWIL2

Friemel, Carolin; Ammerpohl, Ole; Gutwein, Jana; Schmutzler, A. G.; Caliebe, Almuth; Kautza, Monika; Otte, Sebastian; Siebert, Reiner; Bens, Susanne

doi:10.1016/j.fertnstert.2013.12.054

Cited by 37 publications

(31 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Given the position of this variant and the importance of piRNAs in germline development, it is tempting to speculate there might be a miRNA-driven control over the expression of this particular PIWI protein, and loss of such a potential crosstalk between miRNAs and piRNAs might lead to impairment of spermatogenesis. A recent array-based study performed with peripheral blood samples from 30 infertile men of various subgroups has identified two allele-specific methylation-sensitive SNPs in PIWIL1 and PIWIL2, rs10773767 and rs6982089 respectively, indicating DNA methylation differences in these key genes of piRNA pathway are associated with impaired spermatogenesis [109]. These studies indicate that non-coding RNAs may play a crucial role in the etiology of male infertility.…”

Section: Seminal Fluidal Mirnas and Male Infertilitymentioning

confidence: 91%

The role of epigenetics in idiopathic male infertility

Güneş

Arslan

Hekim

et al. 2016

J Assist Reprod Genet

103

View full text Add to dashboard Cite

Infertility is a complex disorder with multiple genetic and environmental causes. Although some specific mutations have been identified, other factors responsible for sperm defects remain largely unknown. Despite considerable efforts to identify the pathophysiology of the disease, we cannot explain the underlying mechanisms of approximately half of infertility cases. This study reviews current data on epigenetic regulation and idiopathic male infertility. Recent data have shown an association between epigenetic modifications and idiopathic infertility. In this regard, epigenetics has emerged as one of the promising research areas in understanding male infertility. Many studies have indicated that epigenetic modifications, including DNA methylation in imprinted and developmental genes, histone tail modifications and short non-coding RNAs in spermatozoa may have a role in idiopathic male infertility.

show abstract

Section: Seminal Fluidal Mirnas and Male Infertilitymentioning

confidence: 91%

The role of epigenetics in idiopathic male infertility

Güneş

Arslan

Hekim

et al. 2016

J Assist Reprod Genet

103

View full text Add to dashboard Cite

show abstract

“…Bisulfite pyrosequencing of the following loci was performed for validation purposes as described before [3]: cg25798782 (chr2: 242,795,283; forward primer: ttagggagatttaagttagagttag; reverse primer (biotinylated): accacctactcacatccct; sequencing primer: tgtagtggaggttagt), cg08460026 (chr2: 204,732,475; forward primer: atgtgtatatatagaaggtatttgaatag; reverse primer (biotinylated): aatctccacttaattatccaaatcct; sequencing primer: tagaaggtatttgaatagaa) and cg26091609 (chr2: 204,734,182; forward primer: ttgtgttgtatgatgttatttatttgttt; reverse primer (biotinylated): actataatctaactaactaaaactactaa; sequencing primer:tttatattagagatattagttt).…”

Section: Main Textmentioning

confidence: 99%

Epigenetic modifications of the immune-checkpoint genes CTLA4 and PDCD1 in non-small cell lung cancer results in increased expression

Marwitz

Scheufele²,

Perner³

et al. 2017

Clin Epigenet

Self Cite

View full text Add to dashboard Cite

Targeting checkpoint inhibitors using monoclonal antibodies results in significantly better outcome of cancer patients compared to conventional chemotherapy. However, the current companion diagnostics to predict response is so far suboptimal, since they base on more or less reliable immunohistochemical approaches. In order to overcome these limitations, we analyzed epigenetic modifications of PDCD1 (PD1), CD274 (PD-L1), and CTLA4 in NSCLC tissues from 39 patients. Results were correlated with transcriptome data. Significant differences in the CpG-methylation patterns between tumor tissues and matched controls were observed for CTLA4 and PDCD1 (PD1) showing a decreased methylation of these genes compared to matched tumor-free tissues from the same patients. Results were confirmed by bisulfide sequencing in an independent validation cohort. Hypomethylation also resulted in increased expression of these genes as shown by transcriptome data. These epigenetic pathways as a hallmark of NSCLC might be useful to generate more precise diagnostic approaches in the future.

show abstract

“…Friemel et al (2014) applied the 450K array to peripheral blood from 30 infertile males aged 27-42 years (median age 35.5) and 10 fertile males aged 21-52 years old (median age 39.5) [33]. They found differential methylation for PIWI L1 and PIWIL2, both genes important in spermatogenesis and the former of which may regulate hematopoietic stem cells.…”

Section: Fertilitymentioning

confidence: 99%

“…Because access to blood specimens is typically much more convenient to obtain from human subjects, the bulk of published studies have used whole blood (sometimes referred to as peripheral blood). A wide variety of phenotypes and health conditions have been studied: aging [4][5][6][7][8], cancer [9][10][11][12], obesity [5,13], cardiovascular disease [14], prenatal exposures/perinatal outcomes [15,16], environmental exposures [17][18][19][20][21][22][23][24] (tobacco in particular [25,26]), inflammatory diseases [27, 28•], psychiatric conditions [21,[29][30][31][32], and fertility [33]. While many of these studies have used candidate gene approaches with bisulfite-pyrosequencing, an increasing number have conducted epigenome-wide association studies (EWAS) using commercially available microarrays such as the Infinium HumanMethylation450 BeadChip assay ("450K," produced by Illumina, Inc.), its predecessor, the Infinium HumanMethylation27 BeadChip ("27K"), or an This article is part of the Topical Collection on Environmental Epigenetics older Illumina product based on the company's GoldenGate product.…”

Section: Introductionmentioning

confidence: 99%

DNA Methylation in Whole Blood: Uses and Challenges

Houseman

Kim

Kelsey

et al. 2015

Curr Envir Health Rpt

114

105

View full text Add to dashboard Cite

Due to its convenience, the blood is commonly used in epigenomic studies, but its heterogeneous nature leads to interpretation difficulties, given the now widely recognized potential for confounding by cell composition effects. Many recent publications have reported significant associations between DNA methylation and a variety of health conditions or exposures. In this review, we summarize many of these recent publications, highlighting the findings in the context of potential cell composition effects, particularly findings that are indicative of immune response or inflammation. While there is substantial evidence for confounding by cell composition, there is nevertheless also evidence for differential DNA methylation suggestive of processes that are not cell mediated. We conclude that important biological insights still may be gained from studying DNA methylation in whole blood, either by investigating the cell composition effects themselves or processes that demonstrate associations even after adjusting for cell composition effects.

show abstract

Array-based DNA methylation profiling in male infertility reveals allele-specific DNA methylation in PIWIL1 and PIWIL2

Cited by 37 publications

References 39 publications

The role of epigenetics in idiopathic male infertility

The role of epigenetics in idiopathic male infertility

Epigenetic modifications of the immune-checkpoint genes CTLA4 and PDCD1 in non-small cell lung cancer results in increased expression

DNA Methylation in Whole Blood: Uses and Challenges

Contact Info

Product

Resources

About