ARMS-PCR methodologies to determine IL-10, TNF-α, TNF-β and TGF-β1 gene polymorphisms

“…Detection of the A and G allele at position Ϫ1082 in the promoter region of the IL-10 gene was carried out using the amplification refractory mutation system polymerase chain reaction (ARMS-PCR) assay as described by Perrey et al 30 The PCR primer sequences were as follows: generic primer (antisense): 5ЈCAGTGCCAACTGAGAATTTGG 3Ј; primer G (sense): 5ЈCTACTAAGGCTTCTTTGGGAC 3Ј; primer A (sense): 5ЈAC-TACTAAGGCTTCTTTGGGAA 3Ј.…”

Section: Dna Extraction and Arms-pcr Assaymentioning

confidence: 99%

Cancer of the uterine cervix may be significantly associated with a gene polymorphism coding for increased IL-10 production

et al. 2001

Self Cite

View full text Add to dashboard Cite

The purpose of our prospective, case-controlled study was to investigate the hypothesis that women who are genetically programmed to produce high or medium levels of IL-10 were more likely to develop cancer of the uterine cervix than individuals genetically predisposed to low IL-10 production. The population was recruited from patients attending gynecological clinics at 2 hospitals in Harare, Zimbabwe. Laboratory tests were performed in the Departments of Immunology, Chemical Pathology and Medical Microbiology, Medical School, University of Zimbabwe, and simultaneously at the Department of Biological Sciences, University of Manchester, United Kingdom. Included in our study were 77 women with histologically proven cancer of the uterine cervix and 69 age-and parity-matched healthy women. All of the patients and healthy controls were from the Shona ethnic group that inhabits northern Zimbabwe. DNA was purified from cervical cytobrush samples obtained from women with cervical cancer. Control DNA was extracted from urine or peripheral blood samples from the healthy women. The Qiagen DNA extraction kit was used. Detection of allele A and/or G at ؊1082 in the promoter region of the IL-10 gene was carried out using the ARMS-PCR technique. Polymorphism in the amplified products was detected by gel electrophoresis in the presence of ethidium bromide and were bands visualized under UV light. The data comprise 77 women who developed invasive cervical cancer and 69 healthy women matched for age and parity. Patients with cancer were significantly (p ‫؍‬ 0.001) more likely to be predisposed to produce higher (A/G) levels of IL-10. The genotype encoding for high (G/G) production of IL-10 was only observed in one cancer patient. The prevalence of low producers of IL-10 in the cancer group was significantly lower than in the healthy women. There were no high producers amongst the healthy women. These data suggest that the genetically acquired ability to produce higher levels of IL-10 may be a significant factor in the development of cervical cancer.

show abstract

“…After DNA extraction amplification by polymerase chain reaction PCR-SSP methodology was performed, using Cytokine Genotyping Tray (One Lambda, Inc., Canoga Park, CA, USA) which provides sequence-specific oligonucleotide primers for amplification of selected IL-10 alleles. IL10 promoter polymorphisms rs1800896 (-1082A>G), rs1800871 (-819C>T) and rs1800872 (-592A>C) were typed following the manufacturer's instructions (27). Primer pairs were designed to have perfect matches only with a single allele or group of alleles.…”

Section: Genotypingmentioning

confidence: 99%

“…An internal control primer pair, that amplified a conserved region of human b-globin gene, was included to verify the integrity of each PCR reaction. Every test required 19 uL of DNA, 180 uL of D-Mix (PCR buffer, dNTPs, MgCL2) and 1 uL de Taq-Polimerase (5 U/uL) to perform the reaction (27).…”

Section: Genotypingmentioning

confidence: 99%