Argatroban Attenuates Leukocyte– and Platelet–Endothelial Cell Interactions After Transient Retinal Ischemia

Abstract

Background and Purpose-Argatroban, a direct thrombin inhibitor, has been shown to reduce neural injury after transient cerebral ischemia. It has also been reported that this neuroprotective effect results from an anticoagulant function. This study was designed to evaluate quantitatively the inhibitory effects of argatroban on leukocyte-and platelet-endothelial cell interactions after transient retinal ischemia. Methods-Retinal ischemia was induced for 60 minutes in male Long-Evans rats by temporary ligation of the optic sheath (nϭ342). Argatroban was administered just after induction of ischemia. Leukocyte and platelet behavior in the retinal microcirculation was then evaluated in vivo with scanning laser ophthalmoscopy. The expression of P-selectin and intracellular adhesion molecule-1 (ICAM-1) was evaluated by reverse transcription-polymerase chain reaction. After 10 days of reperfusion, ischemia-induced retinal damage was evaluated histologically. Results-Treatment with argatroban suppressed leukocyte-endothelial cell interactions; the maximum numbers of rolling and accumulated leukocytes were reduced by 90.1% (PϽ0.05) and 58.7% (PϽ0.05), respectively, at 12 hours after reperfusion. Treatment with argatroban also suppressed platelet-endothelial cell interactions; the maximum numbers of rolling and adhering platelets were reduced by 91.8% (PϽ0.01) and 78.9% (PϽ0.01), respectively, at 12 hours after reperfusion. The expression of P-selectin and ICAM-1 mRNA was suppressed significantly in the argatroban-treated retinas (PϽ0.01). Histologic examination demonstrated the protective effect of argatroban on ischemia-induced retinal damage (PϽ0.01). Conclusions-Argatroban treatment suppressed leukocyte-and platelet-endothelial cell interactions after transient retinal ischemia. This inhibitory effect on postischemic blood cell-endothelial cell interactions might partially contribute to its neuroprotective effects.

Evaluation of Leukocyte-Endothelial Interactions in Retinal Diseases

“…On the basis of the results of these experiments, many investigators have studied various agents that can attenuate tissue damage by suppressing leukocyte-endothelial interactions in the postischemic retina. Antithrombin III [83,84], tacrolimus (FK506) [85], argatroban (direct thrombin inhibitor) [86], statin [87,88], Rho-associated protein kinase inhibitor [89], superoxide dismutase [90], thalidomide [91], selectin ligands/inhibitor (SKK-60060) [92], triamcinolone acetonide [93], ischemic preconditioning [94,95], platelet depression [81], and 17β-estradiol [96] are reported to reduce leukocyte accumulation in the postischemic retina and thereby reduce neural damage.…”

Simvastatin Inhibits Leukocyte Accumulation and Vascular Permeability in the Retinas of Rats with Streptozotocin-Induced Diabetes

“…For semiquantitative PCR, 2 l of each first-strand reaction was then amplified using eNOS-, ICAM-1-, and ␤-actin-specific oligonucleotide primers. 40 PCR amplification was performed with the following conditions: denaturation at 94°C for 1 minute, annealing at 60°C for 1 minute, and polymerization at 72°C for 1 minute. The reaction was performed for 32 cycles for eNOS, 34 cycles for ICAM-1, and 29 cycles for ␤-actin.…”

In Vivo Evaluation of Retinal Injury After Transient Ischemia in Hypertensive Rats

“…Polymerase chain reaction was performed as previously described. 18 The primers were AGCCTCAGGCCTAA-GAGGAC (sense) and AGGGGTCCCAGAGAGGTCTA (antisense) for ICAM-1, and GGCATCCTGACCCTGAAGTA (sense) and GCCATCTCTTGCTCGAAGTC (antisense) for ␤-actin, which was used as the internal standard.…”